Method of preparing natural human thymosin a1 using series expression mode
A thymosin, a natural technology, applied in the field of biological polypeptide preparation, can solve the problems of high cost, complicated operation, environmental pollution, etc., and achieve the effect of simple operation, low cost and simple process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
specific Embodiment 1
[0030] The method for preparing natural human thymosin α1 in a tandem expression mode in specific example 1. The previous preparatory work at first comprises the following steps:
[0031] (1) Translate the 28 amino acids contained in natural human thymosin α1 into the following sequence according to the customary codons of Escherichia coli:
[0032] TCTGATGCTGCTGTAGATACTTCTTCTGAGATTACTACTAAAGACCTAAAGGAGAAGAAGGAAGTTGTCGAAGAGGCTGAGAAC
[0033] AGACTACGACGACATCTATGAAGAAGACTCTAATGATGATTTCTGGATTTCCTCT
[0034] TCTTCCTTCAACAGCTTTCTCGACTCTTG;
[0035] (2) Add the corresponding nucleotides of nucleic acid restriction endonuclease Hind III, methionine, nucleic acid restriction endonuclease BamH I, asparagine, glycine in front of the natural thymosin α1 sequence; The nucleotides corresponding to glycine, nucleic acid restriction endonuclease Bgl II, terminator, nucleic acid restriction endonuclease Xho I are added behind the sequence;
[0036] (3) The two fragments are annealed and e...
specific Embodiment 2
[0083] Except that the cleavage conditions in step (13) were adding hydroxylamine to make the final concentration to 1.0 M, adjusting the pH to 6.0, and reacting at 37° C. for 60 h, the others were the same as in Example 1.
specific Embodiment 3
[0084] Except that the cleavage conditions in step (13) are adding hydroxylamine to make the final concentration to 2.0 M, adjusting the pH to 7.0, and reacting at 45° C. for 72 hours, the others are the same as in Example 1.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com