Preparation process of human recombined parathyroid hormone 1 84

A parathyroid hormone, -PTH84 technology, applied in the direction of parathyroid hormone, botany equipment and methods, microbial-based methods, etc., can solve the problems of low yield, difficult to scale up production, etc., to achieve high yield, excellent effect, The effect of omitting the renaturation step

Inactive Publication Date: 2006-11-15
EAST CHINA UNIV OF SCI & TECH
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existing rhPTH 1-84 preparation methods have the following problems: the yield is low, most of them are expressed as inclusion bodies a

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation process of human recombined parathyroid hormone 1 84
  • Preparation process of human recombined parathyroid hormone 1 84
  • Preparation process of human recombined parathyroid hormone 1 84

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1: construction of engineering bacteria

[0058] Target gene synthesis: The target gene design is shown in Sequence 2, with a full length of 289 bp. Obtained by overlapping extension polymerase chain reaction (gene splicing by over lap extension PCR, SOE PCR), first synthesize the following five primer (Primer) fragments:

[0059] Primer1 (5'CTGGGTACCGATGACGATGACAAGTCTGTGAGTGAAATTCAGCTGATGCATAACCTGGGGAAACATCTGAACT3'),

[0060] Primer2(5'AAAATTGTGCACATCCTGCAGCTTCTTACGCAGCCATTCTACACGCTCCATCGAGTTCAGATGTTTCCCCAG3'),

[0061] Primer3(5'TACGCGGACGCTGGGAACCAGCATCGCGCGGAGCCAGCGGGGCACCCAGGGCAACAAAATTGTGCACATCCTGCA3'),

[0062] Primer4(5'TCTGCCTCGCCCAGGCTTTTTTCATGGCTCTCAACCAAGACATTGTCTTCCTTTTTACGCGGACGCTGGGAACCA3'),

[0063] Primer5 (5'CGCAAGCTTATTCACTGGGATTTAGCTTTAGTTAATACATTCACATCGGCTTTGTCTGCCTCGCCCAGGCTTTT3').

[0064] Four rounds of PCR were performed to synthesize the designed sequence. In the first round of PCR, primer 1 and primer 2 were used as sense and a...

Embodiment 2

[0067] Embodiment 2: Engineering bacteria BL21(DE3) / pET32a(+)-PTH84 fermentation

[0068] Fermentation was carried out in NLF-22 fermenter (BIOENGINEERING, Switzerland), 10L medium was inserted into 500ml seed liquid, the culture temperature was controlled at 30°C, pH 7.0, fed with constant dissolved oxygen (30%) for cultivation, OD600 reached 35, and the final IPTG with a concentration of 0.2mmol was induced for 3 hours to terminate the fermentation, and the cells were collected.

Embodiment 3

[0069] Example 3: Purification of rhPTH 1-84

[0070] The bacterium obtained in Example 2 was suspended in the lysate (50mM imidazole, pH7.0, 20mMPhosphate Buffer (PB)), the wall was broken by a high-pressure homogenizer, and centrifuged; the supernatant was passed through a nickel ion chelating column balanced with the lysate Ni 2+ -Chelating Sepharose FF (Amersham Biosciences, Sweden), eluent (200mM imidazole, pH7.0, 20mM PB) was eluted, and the elution peak was collected; the protein concentration was measured, diluted to 5mg / ml, and enterokinase was added to a final concentration of 0.5U / ml, 37°C, 24 hours; pass the enzymatic solution through a DEAE Sepharose FF (Amersham Biosciences) column (pH 7.8, 20mM PB), collect the flow-through; adjust the pH to 6.5, and pass through a SP Sepharose FF (Amersham Biosciences) column (Equilibrated at pH 6.5, 20mM PB), eluted with 400mM NaCl, pH 6.5, 20mM PB, and collected the eluted peak; passed through a Superdex-75 (Amersham Bioscie...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention discloses a preparing method of the recombination human parathyroid hormone 1-84 by the gene engineering technology. It uses the codon for E.Coli and synthesizes the encoding sequence of the rhPTH1-84 and constructs the carrier and engineering bacteria. The invention is to express the soluble fusion protein contain the whole sequence of the hPTh 1-84 in the E.Coli cytoplasm, then the protein is purified by the chelate chromatography and cut by the enterokinase, next to purify by the ionic exchange and the gel chromatography to get the rhPTH 1-84 which the purity is more than 80%, the yield can reach 300mg/L.

Description

technical field [0001] The invention relates to the preparation of the active protein of parathyroid hormone 1-84, in particular to the preparation of recombinant human parathyroid hormone 1-84 by using genetic engineering technology. Background technique [0002] Human parathyroid hormone (human parathyroid hormone, hPTH) is a linear peptide hormone secreted by the principal cells of the human parathyroid gland. The mature peptide is 84 amino acids in length and is an important hormone in the body that regulates calcium balance and bone remodeling. , can be used as a safe and effective medicine for the treatment of osteoporosis research and development. The current drugs for the treatment of osteoporosis are mainly osteoclast inhibitors, which only act on osteoclasts, can slow down or inhibit the activity of osteoclasts, and inhibit bone resorption, but have a poor effect on bone formation and cannot stimulate osteogenesis The cells produce strong new bone, and cannot rebu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/16C07K14/635C12N1/21C12N15/63C12P21/02C12R1/19
Inventor 刘清海陶欣艺熊玉春刘美云宋庆训马兴元杨忠童望宇魏东芝
Owner EAST CHINA UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap