Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vitreoscilla hemoglobin gene and its uses

A technology of hemoglobin and Vibrio vitreous bacteria, which is applied in the directions of hemoglobin/myoglobin, application, genetic engineering, etc., to achieve the effect of increasing the expression amount, improving the utilization rate and solving the safety problem

Inactive Publication Date: 2006-12-27
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since Hansenula polymorpha can step-by-step integrate multiple genes according to a certain gene dosage ratio, the recombinant bacteria can express the desired genes in an optimal ratio, which has not been reported in other methanolic yeasts

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vitreoscilla hemoglobin gene and its uses
  • Vitreoscilla hemoglobin gene and its uses
  • Vitreoscilla hemoglobin gene and its uses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1. Acquisition of Hansenula polymorpha Hemoglobin Gene Hb Preferring Vitiligo hyaline:

[0024] According to GenBank No.: AY278200 Vitiligo hyaline hemoglobin gene sequence and Hansenula codon preference, optimize the Vitiligo hyaline hemoglobin gene, design the recombined Vitiligo hyaline hemoglobin gene with Hansenula polymorpha preferred codons, and then Using the method of PCR to artificially synthesize the hemoglobin gene of Hansenula polymorpha preferring Vitiligo hyaline. Primer sequences are shown in Table 1.

[0025] name

Sequence (5'-3')

HF1

5′gaattcatggaccaacaaactattaacattattaaggctactgttccagttttgaaggagc 3′

HF2

5′ctattactactactttctacaagaacttgttcgctaagcacccagaggttagaccattg 3′

HF3

5′gggtagacaagagtctttggagcaaccaaaggctttggctatgactgttttggctgctg 3′

HF4

5′ ttgagaacttgccagctattttgccagctgttaagaagattgctgttaagcactgtcaa 3′

HF5

5′gtgttgctgctgctcactacccaattgttggtcaagagttgttgggtgctattaaggag 3′

...

Embodiment 2

[0032] Example 2, the construction of the expression vector containing the recombinant Vitella hyaline hemoglobin gene and the acquisition of engineering bacteria

[0033] 1. Construction of FMD promoter vector and MOX promoter vector

[0034] For the construction process of pHFMDZA and pHMOXZA (pHFMDZA and pHMOXZA see literature Houhui Song, Yong Li, Weihuan Fang, Yunfeng Geng, Xu Wang, Min Wang, BingshengQiu, Development of a set of expression vectors in Hansenula polymorpha, Biotechnology Letters, Volume 25 , Issue 23, Dec 2003, Pages 1999-2006) were transformed to obtain a new FMD promoter vector pHFMDZR25SA-M and a MOX promoter vector pHMOXZR25SA-M. These two vectors contain autonomous replication sequences, HARS (sequence 2) 25SrDNA (sequence 3), these two originals can increase the copy number of the target gene. The termination sequence AOX-TT of pHFMDZA and pHMOXZA were replaced with FMD-TT sequence (SEQ ID NO: 4) and MOX-TT sequence (SEQ ID NO: 5), respectively.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention exposed a kind of vitreoscilla hemoglobin gene and its application. This gene has one of the following Nucleotide sequence: 1) the DNA sequence of sequence 1 in sequence listing; 2) the DNA sequence of functional protein that has more than 90% homology, as well as with the same coding; 3) the sequence that can hybridize with the limited DNA sequence of sequence 1 in sequence listing under the highly stringent conditions. The hansenula anomala gene engineering strains that contain the vitreoscilla hemoglobin gene of this invention can grow and express destination gene under oxygen-poor conditions, so to improve the utilization of oxygen, and avoid of providing pure oxygen to satisfy the demand of vitreoscilla hemoglobin. This approach can increase the expression level and resolve the security issue that use carbinol and pure oxygen at the same time.

Description

technical field [0001] The invention relates to a hyaline hemoglobin gene and its application. Background technique [0002] There is an O in the body 2 The binding protein is hemoglobin. Hemoglobin is now found in bacteria, yeast, plants and animals. Many hemoglobins have a common feature: hemoglobin is a binding protein, composed of globin and heme. Heme is composed of protoporphyrin and ferrous atoms. Each globin molecule has 4 peptide chains, and each peptide chain is combined with a prosthetic group, that is, heme. O 2 binding to Fe 2+ Hemoglobin loosely combines with oxygen to form oxyhemoglobin (HbO 2 ), this kind of oxygenation is easy to carry out when the oxygen partial pressure is high, and it is easy to dissociate when the oxygen partial pressure is low. Red blood cells bind and carry O 2 The process does not affect ferrous ions and will not oxidize them to ferric ions; Fe 3+ Without O 2 Ability, only seen in abnormal methemoglobin. Magnolo et al. expre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/63C12N5/10C12N15/81C12N1/19C07K14/805
Inventor 邱并生牛振东
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com