Recombinant protein Rv3425 and its application of in preparing tuberculosis kit

A rv3425, recombinant protein technology, applied in the field of genetic engineering and diagnostic reagents, can solve the problems of patients with immune system damage, low immunity, and weakened diagnostic value

Inactive Publication Date: 2007-01-03
FUDAN UNIV
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, pure protein derivatives of M. tuberculosis cross-react with environmental mycobacteria and M. novis BCG vaccine strains, so their diagnostic value is weakened
Moreover, since BCG is a live vaccine, it may damage the patient's immune system. Therefore, testing with pure protein derivatives of Mycobacterium tuberculosis may make immunocompromised subjects, such as those who have been vaccinated with BCG or suffer from AIDS, ,Infectious Diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein Rv3425 and its application of in preparing tuberculosis kit
  • Recombinant protein Rv3425 and its application of in preparing tuberculosis kit
  • Recombinant protein Rv3425 and its application of in preparing tuberculosis kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1: Construction of recombinant plasmid pET32a-Rv3425

[0057] Primer Rv3425(P 上 : 5'ACGGGATCCATGCATCCAATGATACCA;P 下 : 5' ATAAGCTTCTACCCGCCCCTGTAGATCTG). Using the H37Rv strain genomic DNA as a template, the Rv3425 gene was amplified by PCR ( figure 1 ). The PCR reaction conditions were as follows: pre-denaturation at 98°C for 5 minutes; denaturation at 98°C for 45 seconds, renaturation at 60°C for 60 seconds, extension at 72°C for 1 minute, 30 cycles; extension at 72°C for 10 minutes. The PCR reaction product of the Rv3425 gene was purified and digested with BamH I and Hind IH, and cloned into the restriction site of BamH I and Hind III of pET32a plasmid. Sequencing showed that the inserted sequence was completely consistent with the corresponding gene sequence of the whole genome of H37Rv tuberculosis in Gene Bank (Rv3425 gene accession number BX842583.1; protein accession number: CAE55596.1).

Embodiment 2

[0058] Embodiment 2: Expression and purification of Rv3425 protein

[0059] Preparation and transformation of Escherichia coli BL21 competent cells. The method is as follows: Inoculate 1% of E. coli into 50ml LB culture medium, 200rpm, overnight at 37°C; transfer to a 50ml centrifuge tube, 0°C, 10min, centrifuge at 6000rpm, 4°C for 10min, discard the supernatant; collect the bacteria, gently Vibrate the bacteria block; slowly add 10mL pre-cooled CaCl 2 (100mmol / L) to suspend the bacteria, ice-bath for 20min, and discard the supernatant as above. Slowly add 100mmol / L pre-cooled CaCl 2 300μL was mixed gently and put into a 1.5ml Eppendorf tube, and kept on ice for 2h. Store at 4°C. Add 1 μl of the identified recombinant plasmid to 20 μL of Escherichia coli competent cells and keep it on ice for 45 minutes. Shake 3 times in the middle to prevent the recipient bacteria from sinking to the bottom. 37°C water bath for 5 minutes. Quickly ice-bath for 2 minutes, then add 800 μl...

Embodiment 3

[0060] Example 3: Detection of IgG reaction of recombinant protein Rv3425 to serum of healthy controls, pulmonary tuberculosis and extrapulmonary tuberculosis patients.

[0061] Use ELISA indirect method to detect the IgG reaction against Rv3425 in different serum samples. The specific steps are: 96-well plate is coated with antigen Rv3425 (concentration: 5 μg / mL) overnight, and then the plate is washed 3 times with 400 μL / well of PBST , each time for 3 minutes, followed by blocking with 1% BSA in PBS (350 μL / well) and incubating at 37°C for 2 hours, then washing the plate three times with PBST 400 μL / well, each time for 3 minutes, and then adding 1:100 diluted to-be-tested Serum (100 μL / well) was incubated at 37°C for 1 h, and the plate was also washed 5 times with 400 μL / well of PBST for 5 minutes each time; then 400ul of freshly diluted enzyme-labeled antibody (1:1000 dilution) was added. Incubate at 37°C for 1 hour, and then wash the plate 5 times with 400 μL / well of PBST,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of gene engineering and diagnosis reagent technology, and aims at providing specific Rv3425 antigen for detecting tuberculosis and superior to available tuberculosis detecting reagent. The present invention provides specific Rv3425 antigen with high sensitivity in detecting pulmonary tuberculosis and other kinds of tuberculosis. The specific Rv3425 antigen as one immune dominant B-cell target antigen is used in preparing tuberculosis detecting reagent kit with high sensitivity, high safety and high reliability.

Description

technical field [0001] The invention belongs to the fields of genetic engineering and diagnostic reagents. Specifically, the invention relates to a novel tuberculosis diagnostic reagent, its preparation method and application. Background technique [0002] Currently, skin detection reagents—purified protein derivatives of Mycobacterium tuberculosis—are widely used in the diagnosis of tuberculosis. However, pure protein derivatives of Mycobacterium tuberculosis cross-react with environmental mycobacteria and M. novis BCG vaccine strains, so their diagnostic value is weakened. Moreover, since BCG is a live vaccine, it may damage the patient's immune system. Therefore, testing with pure protein derivatives of Mycobacterium tuberculosis may make immunocompromised subjects, such as those who have been vaccinated with BCG or suffer from AIDS, ,Infectious Diseases. AIDS patients happen to be a high-risk group of tuberculosis. Therefore, it is very urgent to develop a safe and sp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/31C07K14/195C12N15/09C12P21/02C12N1/21G01N33/68C12R1/19
Inventor王洪海张红梅王九玲雷建强张旻杨燕萍
OwnerFUDAN UNIV