Antiobesity drug

An obesity and amino acid technology, applied in drug combinations, pharmaceutical formulations, growth factors/inducible factors, etc., can solve problems such as ignorance of the physiological function of AGF

Inactive Publication Date: 2007-06-13
ASTELLAS PHARMA INC
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the physiological functions of AGF other than the above are not known

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antiobesity drug
  • Antiobesity drug
  • Antiobesity drug

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0104] Hereinafter, although an Example demonstrates this invention concretely, it does not limit the scope of the present invention. In addition, unless otherwise specified, it can implement according to a well-known method ("Molecular Cloning", Sambrook, J etc., Cold Spring Harbor Laboratory Press, 1989 etc.). Also, when using a commercially available reagent or kit, it can be carried out according to the instructions of the commercially available product.

[0105] Regarding the preparation of gene knockout animals and transgenic animals, if there is no special instructions, it can be obtained according to Manipulating the Mouse Embryo.A Laboratory Manual.2nd Edition, B.Hogan, R.Beddington, F.Costantini, E.Lacy, Cold Spring Harbor , New York, Cold Spring Harbor Laboratory Press, 1994 implementation; Regarding the preparation of chimeric mice using ES cells, it can be based on AL Joyner: Gene Targeting, A Practical Approach, OXFORD UNIVERSITY PRESS, 1993 or バイオマニュアルシリズ 8, ジ O...

reference example 1

[0106] "(Reference Example 1: Preparation of AGF KO Mice"

[0107] (1) Preparation of target carrier

[0108] The following method was used to prepare the genome sequence (5' long arm (long arm)) of the 5' side of the mouse AGF gene, the pgk promoter, the neomycin resistance gene, and the exon containing the mouse AGF gene ( A part of exon) 2 and the genomic sequence (3' short arm (shortarm)) of exon 3, and the target carrier of HSV-tk gene.

[0109] That is, cDNA corresponding to the full-length protein coding region of mouse AGF was prepared in the same manner as in Example 1 of WO03 / 083114. The cDNA was used as a probe to screen the mouse genome library (Mouse Genomic, 129 SVJ Library; Stratagene Company) according to the attached instructions, and isolate a sequence with about 17.9 kbp (containing AGF gene, mouse-pub-genome sequence ACO73775.2 90644 ~ 108544) of the phage clone, subcloned in the plasmid pBlueseript (Stratagene Company). The plasmid clone (pBN2) was cut ...

Embodiment 1

[0124] "Example 1: Preparation of CAG-AGF Tg mice"

[0125] In this example, AGF transgenic mice (hereinafter referred to as AGF transgenic mice (hereinafter referred to as CAG-AGF Tg mice). Prepare the CAG promoter (1.7kp), lox71 sequence, blasticidin gene (bsr), Poly A signal sequence ( 0.5kb), lox P sequence, mouse AGF cDNA sequence and IRES (internal ribosomal entry site)-β-geo-Poly A sequence (4.5kb) plasmid.

[0126] Mouse AGF full-length cDNA (WO03 / 083114 bulletin) was used as a template, and the DNA composed of the base sequence shown in sequence number 13 (AGAAGCTTCACCATGGGGACCGCCAGGCTAC artificial sequence) and sequence number 14 (CCGTCGACATTAGATCTTCACAAGCGCAAGCCGGGTC artificial sequence) was used as a primer set to perform PCR (95 After reacting at °C for 10 minutes, 45 reaction cycles of 94°C for 15 seconds, 60°C for 30 seconds, and 72°C for 2 minutes) were performed, and the obtained PCR product was subcloned into pZErO-2 cloning vector (Invitrogen). The obtain...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

An antiobesity drug, a remedy for diabetes and / or a remedy for hyperlipemia containing angiopoietin-related growth factor (AGF) or a polynucleotide encoding the same as the active ingredient; a functional food or a health food containing AGF as the active ingredient and having a function of ameliorating obesity, diabetes and / or hyperlipemia imparted thereto; a method of preventing or treating obesity, diabetes and / or hyperlipemia which comprises administering AGF or a polynucleotide encoding the same; and utilization of AGF or a polynucleotide encoding the same for producing an antiobesity drug, a remedy for diabetes and / or a remedy for hyperlipemia.

Description

technical field [0001] The present invention relates to an anti-obesity drug containing angiopoietin-related growth factor (Angiopoietin-Related Growth Factor; hereinafter referred to as AGF), its derivative or its encoded polynucleotide as an active ingredient. The anti-obesity drug of the present invention can be administered not only as a pharmaceutical product, but also in the form of a food or drink that is a health food (preferably a functional food) or a drink. Background technique [0002] Despite the well-known harmful effects of obesity, obesity has increased significantly in recent years. It is well known that obesity, that is, excessive accumulation of adipose tissue, is a cause of various diseases, and therefore obesity as a disease is advocated as a therapeutic object. Diseases caused by obesity, such as low back pain, knee pain, and osteoarthritis. Weight gain due to obesity is the direct cause of these orthopedic diseases. Excess accumulation of fat accomp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K38/22A23L1/305A61K48/00A61P3/04A61P3/06A61P3/10C07K14/475C12N15/09A23L33/18
Inventor安永邦夫山地升须田年生尾池雄一
OwnerASTELLAS PHARMA INC