Unlock instant, AI-driven research and patent intelligence for your innovation.

Non-human primate Fc receptors and methods of use

a technology of human primate fc and receptor, which is applied in the field of nonhuman primate fc receptor, can solve the problems of missing information regarding the interaction of human antibodies with primate fc, and achieve the effects of facilitating oligomerization of protein, facilitating purification of fusion protein, and enhancing stability of fusion protein

Inactive Publication Date: 2005-03-10
GENENTECH INC
View PDF1 Cites 96 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The invention provides polynucleotides and polypeptides of non-human primate Fc receptors and beta-2 microglobulin, which are useful for evaluating the binding of antibodies to these receptors in animals prior to in vivo evaluation in primates. The polynucleotides and polypeptides can also be used to produce fusion proteins with other molecules for various functions such as purification, stability, or secretion. The invention also includes methods for amplifying and isolating the polynucleotides, as well as vectors, plasmids, and host cells for the production of the polypeptides. The non-human primate Fc.gamma. receptors are particularly useful for safety and efficacy evaluation of therapeutic antibodies.

Problems solved by technology

However, there is only sparse information available regarding the interaction of human antibodies with primate Fc.gamma. receptors and the effects of this interaction on interpretation of pharmacokinetic, toxicity, and efficacy studies in primates.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Non-human primate Fc receptors and methods of use
  • Non-human primate Fc receptors and methods of use
  • Non-human primate Fc receptors and methods of use

Examples

Experimental program
Comparison scheme
Effect test

example 1

Molecular Cloning of Cynomolgus and Chimp Fc Receptor DNA and .beta.-2 Microglobulins

[0154] Materials and Methods:

Cloning of Cynomolgus Monkey Fc.gamma.R

[0155] Since cynomolgus monkey DNA shares approximately 90% homology to human DNA, a series of PCR primers for each Fc.gamma.R was designed based on the sequence of the corresponding human receptor. Each sense primer starts at a site immediately 5' of the coding region or at the start of the coding region. The antisense primers were designed in the same way, i.e. immediately 3' of the C terminal stop codon or at the C terminal stop codon. Primers incorporated endonuclease restriction sites used to subclone PCR product into a pRK vector (Eaton et al.). The sequences of the primers are shown in Table 1.

2TABLE 1 Restriction sites are underlined. Receptor Cyno Fc.gamma.RI Full-Length Forward CAGGTCAATCTCTAGACTCCCACCAGCTTGGAG Primer (SEQ ID NO: 31) Reverse GGTCAACTATAAGCTTGGACGGTCCAGATCGAT Primer (SEQ ID NO: 32) Restriction XbaI / HindIII ...

example 2

Alignment of Nucleotide and Amino Acid Sequences of Cynomolgus, Chimp and Human Fc.gamma.R

[0160] Nucleotide and amino acid sequences for FcR polypeptides from human, cynomolgus and chimps were aligned and % sequence identity calculated.

[0161] Nucleotide and amino acid sequences of primate and human proteins were aligned manually and differences in nucleotide or protein sequence noted. Percent identity was calculated as [number of identical residues] / [number of total residues]. When the sequences differed in the total number of residues, two values for percent identity are provided, using the two different numbers for total residues. Nucleotide sequences begin at the coding sequence for the signal sequence.

[0162] The alignment of nucleic acid sequences for human (SEQ ID NO: 2) and cynomolgus Fc.gamma.RI .alpha.-chain (SEQ ID NO: 1) as shown in Table 3 below. The dots indicate locations of nucleotide sequence differences. An analysis of the % sequence identity shows that the human and...

example 3

Cynomolgus Fe.gamma.RI And Human Fc.gamma.RI Bind Human IgG Subclasses Equivalently

[0213] Materials and Methods:

[0214] Human IgG2, IgG3, and IgG4 isotypes of E27 (IgG 1) were constructed by subcloning the appropriate heavy chain Fc cDNA from a human spleen cDNA library into a pRK vector containing the E27 variable heavy domain. All IgG subclasses and variants were expressed using the same E27 .kappa. light chain as described in Shields, R. L., Namenuk, A. K., Hong, K., Meng, Y. G., Rae, J., Briggs, J., Xie, D., Lai, J., Stadlen, A., Li, B., Fox, J. A., and Presta, L. G. (2001) J. Biol. Chem. 276:6591-6604 or U.S. Pat. No. 6,194,551.

[0215] Following cotransfection of heavy and light chain plasmids into 293 cells, IgG1, IgG2, IgG4 and variants were purified by protein A chromatography. IgG3 was purified using protein G chromatography. All protein preparations were analyzed using a combination of SDS-polyacrylamide gel electrophoresis, ELISA, and spectroscopy.

[0216] The cDNA for Human ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
δ δ δ δaaaaaaaaaa
δ δ δ δaaaaaaaaaa
δ δaaaaaaaaaa
Login to View More

Abstract

The invention provides isolated non-human primate Fc receptor polypeptides, the nucleic acid molecules encoding the Fc receptor polypeptides, and the processes for production of recombinant forms of the Fc receptor polypeptides, including fusions, variants, and derivatives thereof. The invention also provides methods for evaluating the safety, efficacy and biological properties of Fc region containing molecules using the non-human primate Fc receptor polypeptides.

Description

[0001] The invention generally relates to purified and isolated non-human primate Fc receptor polypeptides, the nucleic acid molecules encoding the FcR polypeptides, and the processes for production of non-human primate Fc receptor polypeptides as well as to methods for evaluating the safety, efficacy and biological properties of therapeutic agents.[0002] Fc receptors (FcRs) are membrane receptors expressed on a number of immune effector cells. Upon interaction with target immunoglobulins, FcRs mediate a number of cellular responses, including, activation of cell mediated killing, induction of mediator release from the cell, uptake and destruction of antibody coated particles, and transport of immunoglobulins. Deo et al., 1997, Immunology Today 18:127-135. Further, it has been shown that antigen-presenting cells, e.g., macrophages and dendritic cells, undergo FcR mediated internalization of antigen-antibody complexes, allowing for antigen presentation and the consequent amplificatio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C07K14/705C07K14/735C07K16/32C07K16/42G01N33/50C07K19/00C12N5/10C12N15/09C12Q1/02G01N33/15
CPCC07K14/70535C07K16/32C07K16/4291C07K2317/52C07K2319/02G01N33/566C07K2319/00
Inventor PRESTA, LEONARD G.NAMENUK, ANGELA K.
Owner GENENTECH INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More