Unlock instant, AI-driven research and patent intelligence for your innovation.

Primate prokineticin and prokineticin receptor polypeptides, related compositions and methods

a technology of prokineticin and prokineticin, applied in the field of primate prokineticin and prokineticin receptor polypeptides, can solve the problems of unwanted changes at the cellular, tissue and whole organism level, and achieve the effect of promoting the production of a pkr1 signal

Inactive Publication Date: 2006-01-26
RGT UNIV OF CALIFORNIA
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0011] SEQ ID NO:30. Further provided is a method of identifying a PKR1 agonist using the rhesus monkey PKR1. The method involves (a) contacting a PKR1 polypeptide containing an amino acid sequence referenced as SEQ ID NO:30 with one or more candidate compounds, and (b) identifying a compound that selectively promotes production of a PKR1 signal, said compound being characterized as an agonist of said PKR1.
[00

Problems solved by technology

If this normal signaling is disrupted, for example, due to disease, unwanted changes can occur at the cellular, tissue and whole organism level.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primate prokineticin and prokineticin receptor polypeptides, related compositions and methods
  • Primate prokineticin and prokineticin receptor polypeptides, related compositions and methods
  • Primate prokineticin and prokineticin receptor polypeptides, related compositions and methods

Examples

Experimental program
Comparison scheme
Effect test

example i

Cloning of Rhesus Monkey PK2

[0105] This example describes cloning of a rhesus monkey prokineticin 2 cDNA.

[0106] PCR methods were used to obtain a full-length rhesus monkey PK2 cDNA from reverse-transcribed RNA isolated from rhesus monkey testis. The rhesus monkey PK2 cDNA was amplified with Pfu polymerase using the following primers for PCR: GGCGCCATGAGGAGCCTGTGCTGC (SEQ ID NO:17) and ATTATTCTGATACAGAATTTT (SEQ ID NO:18) followed by nested PCR using the following primers: GGCGCCATGAGGAGCCTGTGCTGC (SEQ ID NO:19) and CTCTTCAAGTGACATTTTCTA (SEQ ID NO:20). The Pfu-catalyzed PCR amplification was carried out for 30 cycles with each cycle consisting of 94° C. denaturing for 30 seconds, 55° annealing for 45 seconds, 68° C. elongation for 90 seconds. The PCR product was cloned into PCRII vector (INVITROGEN CORPORATION, Carlsbad, Calif.) and confirmed by DNA sequencing.

example ii

Cloning of Squirrel Monkey PKR2

[0107] This example describes cloning of a squirrel monkey prokineticin receptor 2 cDNA.

[0108] PCR methods were used to obtain a full-length squirrel monkey PKR2 cDNA from reverse-transcribed RNA isolated from squirrel monkey brain. The squirrel monkey PKR2 cDNA was amplified with Pfu polymerase using the following oligonucleotide primers:

[0109] ATCACCATGGCAGCCCAGAATGGAAACACCAG (SEQ ID NO:21) and TCACTTCAGCCTGATACAGTCCAC (SEQ ID NO:22). The Pfu-catalyzed PCR amplification was carried out for 50 cycles with each cycle consisting of 94° C. denaturing for 30 seconds, 58° C. annealing for 45 seconds, 68° C. elongation for 90 seconds. The PCR product was cloned into PCRII vector (INVITROGEN CORPORATION, Carlsbad, Calif.) and confirmed by DNA sequencing. For calcium mobilization assays described herein below, the squirrel monkey PKR2 was cloned into pcDNA3.1Zeo (INVITROGEN CORPORATION, Carlsbad, Calif.).

example iii

Cloning of Chimpanzee PKR2

[0110] This example describes cloning of a chimpanzee prokineticin receptor 2 cDNA.

[0111] PCR methods were used to obtain a full-length chimpanzee (Pan troglodytes) PKR2 cDNA from reverse-transcribed RNA isolated from chimpanzee salivary gland tissues. The chimpanzee PKR2 cDNA was amplified with Pfu polymerase using the following primers

[0112] ATCACCATGGCAGCCCAGAATGGAAACACCAG (SEQ ID NO:23), ATYGCCATTGACAGATATCTYGCCATYGTTCACCCC (Y: T or C)(SEQ ID NO:24), AGATATCTGTCAATGGCRATGGCCAGCAAGGCATTG (R: A or G)(SEQ ID NO:25), and TCACTTCAGCCTGATACAGTCCAC (SEQ ID NO:26). The Pfu-catalyzed PCR amplification was carried out for 45 cycles with each cycle consisting of 94° C. denaturing for 30 seconds, 58° C. annealing for 45 seconds, 68° C. elongation for 90 seconds. The PCR products of primer 1 and 2 (product 1) and those of primer 3 and 4 (product 2) were cloned into PCRII vector (INVITROGEN CORPORATION, Carlsbad, Calif.) and confirmed by DNA sequencing. The comple...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an isolated squirrel monkey prokineticin receptor 2 (PKR2) polypeptide containing the amino acid sequence referenced as SEQ ID NO:2; an isolated chimpanzee PKR2 containing the amino acid sequence referenced as SEQ ID NO:4; and an isolated rhesus monkey prokineticin receptor 1 (PKR1) referenced as SEQ ID NO:30. Also provided are methods of identifying PKR1 and PKR2 agonists and antagonists using the newly identified PKR2 and PKR1 polypeptides. Additionally, the invention provides an isolated rhesus monkey PK2 polypeptide containing the amino acid sequence referenced as SEQ ID NO:6, and an isolated rhesus monkey PK1 polypeptide containing the amino acid sequence referenced as SEQ ID NO:28. Nucleic acid molecules encoding the disclosed polypeptides further are provided by the invention.

Description

CLAIM FOR PRIORITY [0001] This application claims benefit of priority from U.S. Provisional Application Ser. No. 60 / 550,753, filed Mar. 5, 2004, the entire contents of which are incorporated herein by reference.BACKGROUND OF THE INVENTION [0002] Prokineticins are secreted proteins that have roles in several biological functions, including circadian rhythm; angiogenesis; gastric contractility and motility; gastric acid and pepsinogen secretion; pain; and neurogenesis. Prokineticin 1 (PK1) and prokineticin 2 (PK2) induce cellular responses by binding to G-protein coupled receptors termed prokineticin receptor 1 (PKR1) and prokineticin receptor 2 (PKR2), resulting in activation of receptor signaling. Normal prokineticin receptor signaling contributes to the development and function of a variety of tissues in humans. If this normal signaling is disrupted, for example, due to disease, unwanted changes can occur at the cellular, tissue and whole organism level. These changes can be manife...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/705C07H21/04C12P21/06C12N5/06
CPCC07K14/705
Inventor ZHOU, QUN-YONG
Owner RGT UNIV OF CALIFORNIA