Primate prokineticin and prokineticin receptor polypeptides, related compositions and methods
a technology of prokineticin and prokineticin, applied in the field of primate prokineticin and prokineticin receptor polypeptides, can solve the problems of unwanted changes at the cellular, tissue and whole organism level, and achieve the effect of promoting the production of a pkr1 signal
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example i
Cloning of Rhesus Monkey PK2
[0105] This example describes cloning of a rhesus monkey prokineticin 2 cDNA.
[0106] PCR methods were used to obtain a full-length rhesus monkey PK2 cDNA from reverse-transcribed RNA isolated from rhesus monkey testis. The rhesus monkey PK2 cDNA was amplified with Pfu polymerase using the following primers for PCR: GGCGCCATGAGGAGCCTGTGCTGC (SEQ ID NO:17) and ATTATTCTGATACAGAATTTT (SEQ ID NO:18) followed by nested PCR using the following primers: GGCGCCATGAGGAGCCTGTGCTGC (SEQ ID NO:19) and CTCTTCAAGTGACATTTTCTA (SEQ ID NO:20). The Pfu-catalyzed PCR amplification was carried out for 30 cycles with each cycle consisting of 94° C. denaturing for 30 seconds, 55° annealing for 45 seconds, 68° C. elongation for 90 seconds. The PCR product was cloned into PCRII vector (INVITROGEN CORPORATION, Carlsbad, Calif.) and confirmed by DNA sequencing.
example ii
Cloning of Squirrel Monkey PKR2
[0107] This example describes cloning of a squirrel monkey prokineticin receptor 2 cDNA.
[0108] PCR methods were used to obtain a full-length squirrel monkey PKR2 cDNA from reverse-transcribed RNA isolated from squirrel monkey brain. The squirrel monkey PKR2 cDNA was amplified with Pfu polymerase using the following oligonucleotide primers:
[0109] ATCACCATGGCAGCCCAGAATGGAAACACCAG (SEQ ID NO:21) and TCACTTCAGCCTGATACAGTCCAC (SEQ ID NO:22). The Pfu-catalyzed PCR amplification was carried out for 50 cycles with each cycle consisting of 94° C. denaturing for 30 seconds, 58° C. annealing for 45 seconds, 68° C. elongation for 90 seconds. The PCR product was cloned into PCRII vector (INVITROGEN CORPORATION, Carlsbad, Calif.) and confirmed by DNA sequencing. For calcium mobilization assays described herein below, the squirrel monkey PKR2 was cloned into pcDNA3.1Zeo (INVITROGEN CORPORATION, Carlsbad, Calif.).
example iii
Cloning of Chimpanzee PKR2
[0110] This example describes cloning of a chimpanzee prokineticin receptor 2 cDNA.
[0111] PCR methods were used to obtain a full-length chimpanzee (Pan troglodytes) PKR2 cDNA from reverse-transcribed RNA isolated from chimpanzee salivary gland tissues. The chimpanzee PKR2 cDNA was amplified with Pfu polymerase using the following primers
[0112] ATCACCATGGCAGCCCAGAATGGAAACACCAG (SEQ ID NO:23), ATYGCCATTGACAGATATCTYGCCATYGTTCACCCC (Y: T or C)(SEQ ID NO:24), AGATATCTGTCAATGGCRATGGCCAGCAAGGCATTG (R: A or G)(SEQ ID NO:25), and TCACTTCAGCCTGATACAGTCCAC (SEQ ID NO:26). The Pfu-catalyzed PCR amplification was carried out for 45 cycles with each cycle consisting of 94° C. denaturing for 30 seconds, 58° C. annealing for 45 seconds, 68° C. elongation for 90 seconds. The PCR products of primer 1 and 2 (product 1) and those of primer 3 and 4 (product 2) were cloned into PCRII vector (INVITROGEN CORPORATION, Carlsbad, Calif.) and confirmed by DNA sequencing. The comple...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



