Gel having biosubstance fixed thereto and microarray utilizing the gel

a biosubstance and gel technology, applied in the field of biosubstance-immobilized gel and biological substance-immobilized gel microarray, can solve the problems of lower fluorescence intensity in the center region and higher in the outer region of the compartment, and achieve the effect of high hybridization efficiency

Inactive Publication Date: 2006-04-20
MITSUBISHI RAYON CO LTD
View PDF6 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0007] The object of the present invention is to obtain gel composition which ensures a uniform distribution of fluorescence intensity in each compartment and provides a higher value for total fluorescence intensity summed over the entire area of each compartment, i.e., higher hybridization efficiency in the detection of a microarray after hybridization.
[0008] As a result of extensive and intensive efforts made to overcome the problem stated above, the inventors of the present invention have found that when capture probes are immobilized on and / or in a gel satisfying the following properties, it is possible to ensure a uniform distribution and increased level of fluorescence intensity in each compartment, i.e., higher hybridization efficiency. This finding led to the completion of the present invention.
[0053] An analyte containing biological substances to be detected (e.g., nucleic acids such as DNA) is prepared, added to the microarray and then reacted with biological substances immobilized on and / or in the gel of the microarray. For example, DNA targets to be measured are fluorescently labeled and then hybridized with DNA in the microarray. Subsequently, the microarray is washed to remove unreacted DNA, followed by detection of fluorescence intensity. The fluorescence intensity may be detected using any device (e.g., a commercially available DNA detector). According to the present invention, the inventive “biological substance-immobilized gel which comprises a gel containing 2%-7% by mass of N,N-dimethylacrylamide and a biological substance immobilized on and / or in the gel” has good reactivity and ensures uniform fluorescence intensity per compartment of a microarray, thus providing highly sensitive detection results.

Problems solved by technology

However, there has been a problem that when the microarrays after hybridization are measured for fluorescence intensity in each of their compartments where capture probes are immobilized, the fluorescence intensity is higher in the outer regions of the compartments, but lower in the center regions of the compartments.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gel having biosubstance fixed thereto and microarray utilizing the gel

Examples

Experimental program
Comparison scheme
Effect test

example 1

(1) Production of Polymethylmethacrylate (PMMA) Hollow Fibers

[0057] An acrylic resin with a mass molecular weight of about 90,000, which was composed of methyl methacrylate (MMA) and methyl acrylate (MA) in a monomer ratio of 82:18, was used as a source material and melt-extruded using an extruder through a spinning nozzle having a circular outlet, thereby obtaining hollow fibers with an outer diameter of 0.3 mm, an inner diameter of 0.2 mm and a length of 600 mm.

(2) Production of a Hollow Fiber Alignment

[0058] Two perforated plates of 0.1 mm thickness were placed one upon another, each of which had 9 holes (diameter: 0.32 mm; center-to-center distance: 0.42 mm) arranged in a 3 by 3 array, and 9 hollow fibers prepared above were then threaded through the respective holes in these perforated plates. The space between these two perforated plates was set to 50 mm and the hollow fibers were fixed under tension at two points, 50 mm and 100 mm from one end.

[0059] A resin raw materia...

example 2

[0085] The same procedure as used in Example 1 was repeated to prepare slices, except that monomer solution A and capture probe A were replaced by monomer solution D and capture probe B (SEQ ID NO: 5), respectively. Capture probe B was constructed to have a terminal methacrylate group by introducing an amino group at the 5′-terminus and then reacting the same with glycidyl methacrylate.

[Monomer Solution D]

[0086] Dimethylacrylamide (0.27 g) and methylenebisacrylamide (0.03 g) were dissolved in a 50 / 50 (by mass) mixture of glycerine and pure water to give a total volume of 10 ml.

[Capture probe B (SEQ ID NO: 5)]aaatacgcct gcaggcggag atcttccagg cccgcctcaagggctggttc gagccaatag tggaagacat

[0087] Hybridization and washing were performed as follows.

(1) Hybridization

[0088] A hybridization solution was prepared, which was supplemented with 1 pmol / ml oligonucleotide E (SEQ ID NO: 6) including, as a part thereof, a complementary sequence to the nucleotide sequence of capture probe B (nucl...

example 3

[0096] The same procedure as used in Example 2 was repeated, except that monomer solution D was replaced by monomer solution A. FIG. 2 shows the fluorescence intensity per compartment, along with an image of the washed hollow fiber and its surrounding area. The center of each compartment was determined as appropriate. As a result, the distribution of fluorescence intensity in the hybridized compartments was uniform.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Surface areaaaaaaaaaaa
Massaaaaaaaaaa
Lengthaaaaaaaaaa
Login to View More

Abstract

The present invention provides a biological substance-immobilized gel which comprises a gel containing 2%-7% by mass of N,N-dimethylacrylamide and a biological substance immobilized on and / or in the gel.

Description

TECHNICAL FIELD [0001] The present invention relates to a biological substance-immobilized gel and a biological substance-immobilized gel microarray using the same. The microarray is used for analysis of gene expression, etc. BACKGROUND ART [0002] The decoding of human genome is now progressing and helping clarify causal relations between various diseases or diatheses and specific gene sequences. For example, such a gene analysis is intended to use for predicting the onset of diseases, side effects of drugs, etc. [0003] A means conventionally used for gene analysis is gel-based electrophoresis. In recent years, capillary gel electrophoresis has been developed with the aim of separating and analyzing trace amounts of biological samples in a short time. Capillary gel electrophoresis uses glass capillaries filled with a hydrogel such as acrylamide. [0004] In addition, microarrays carrying multiple capture probes for DNA or protein detection (i.e., probes capable of capturing target DNA...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68B01J19/00C40B40/02C40B50/06
CPCB01J2219/00641B01J2219/00585Y10T428/1352B01J2219/00317B01J2219/00639B01J2219/0052B01J2219/00596B01J2219/00576B01J2219/00659B01J2219/00722B01J19/0046B01J2219/00644B01J2219/00673B01J2219/00524G01N33/53G01N37/00C12M1/00
InventorNAGAHAMA, CHIAKIITOU, CHIHO
OwnerMITSUBISHI RAYON CO LTD