Method for propagating adenoviral vectors encoding inhibitory gene products

a technology of adenoviral vectors and inhibitors, applied in the field of methods for propagating adenoviral vectors encoding inhibitory gene products, can solve the problems of increasing the time required to generate viable adenoviral vector particles, delivering proteins as therapeutics, and vaccine developmen

Inactive Publication Date: 2008-09-25
GEN VEC INC
View PDF3 Cites 54 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Delivery of proteins as therapeutics or for inducing an immune response in biologically relevant amounts has been an obstacle to drug and vaccine development for decades.
A high level of transgene expression, however, often is inhibitory to virus growth, such as when the transgene encodes a protein that is cytotoxic to a packaging cell.
Such gene regulation systems, however, often require the use of inducer compounds (e.g., tetracycline analogs), which increases the time required to generate viable adenoviral vector particles, thereby complicating their widespread use.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0072]This example demonstrates a method of inhibiting gene expression from an adenoviral vector according to the inventive method.

[0073]An oligonucleotide containing two copies of the tet operator (5′-AGCTCTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGATCGTCGACGA GCT-3′) (SEQ ID NO: 1) was self-annealed, digested with SacI, and inserted at the SacI site between the TATA box and transcription start site of the CMV enhancer / promoter (GenBank X17403, nucleotides 174,314 to 173,566). An artificial untranslated sequence (UTR) of 144 base pairs and 3′ splice site sequences were inserted downstream of the CMV sequences, followed by a nucleic acid sequence encoding green fluorescent protein (GFP) and a simian virus-40 (SV40) polyadenylation signal. The resulting CMV-tetO expression cassette was transferred to a shuttle plasmid containing adenovirus type 5 nucleotides 1-355 and 3333-5793 or 3511-5793 flanking the expression cassette and a restriction site for linearization.

[0074]Adenoviral vector ...

example 2

[0079]This example demonstrates a method of inhibiting gene expression from an adenoviral vector according to the inventive method.

[0080]293 cells expressing tetR (293TetR) and lacking tetR (293BB) were generated as described in Example 1. Cells were infected with E1-deleted adenoviral vectors that expressed secreted alkaline phosphatase (SEAP) from constitutive (AdSeap) and regulatable (AdTetO.Seap) expression cassettes. The level of SEAP activity in the culture medium was determined (Phospha-Light™ Kit, Applied Biosystems, Foster City, Calif.) at three early phase time points: 8, 10, and 12 hours post-infection (h.p.i.) and at one time point after significant DNA replication (24 h.p.i.). The level of SEAP activity was specifically reduced in the 293TetR cells infected with AdtetO.Seap. SEAP activity was not reduced in 293BB cells infected with AdtetO.Seap, as compared to 293BB cells infected with AdSeap. The level of SEAP activity was reduced by the tetO vector-tetR cell combinati...

example 3

[0083]This example demonstrates a method of propagating an adenoviral vector comprising a nucleic acid sequence encoding a toxic protein in accordance with the inventive method.

[0084]Seven adenoviral vectors comprising an expression cassette under the control of a CMV promoter inserted into a deleted E1 region could not be propagated to form a stock of viable adenoviral vectors using standard 293 or 293-ORF6 cells. The transgenes encoded by the adenoviral vectors included human transforming growth factor beta-1 (TGFβ) (Wettergreen et al., Eur. J. Oral Sci., 109, 415-421 (2001), two peptide antibiotics, two viral envelope glycoproteins, and two malaria parasite proteins. In contrast, adenoviral vectors encoding each of these genes could be propagated using the tetR / tetO system described herein. To illustrate, an E1-deleted adenoviral vector comprising the CMV-tetO expression cassette was constructed in accordance with the description herein (see, e.g., Example 1). The adenoviral vect...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pHaaaaaaaaaa
temperatureaaaaaaaaaa
ionic strengthaaaaaaaaaa
Login to View More

Abstract

The invention provides a method of propagating an adenoviral vector. The method comprises (a) providing a cell comprising a cellular genome comprising a nucleic acid sequence encoding a tetracycline operon repressor protein (tetR), and (b) contacting the cell with an adenoviral vector comprising a heterologous nucleic acid sequence encoding a toxic protein. The heterologous nucleic acid sequence is operably linked to a promoter and one or more tetracycline operon operator sequences (tetO), and expression of the heterologous nucleic acid sequence is inhibited in the presence of tetR, such that the adenoviral vector is propagated. The invention also provides a system comprising the aforementioned cell and adenoviral vector.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This patent application is a continuation of copending International Patent Application No. PCT / US2006 / 060732, filed Nov. 8, 2006, designating the United States, which claims the benefit of U.S. Provisional Patent Application No. 60 / 735,578, filed Nov. 10, 2005.INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY[0002]Incorporated by reference in its entirety herein is a computer-readable nucleotide / amino acid sequence listing submitted concurrently herewith and identified as follows: One 2,357 Byte ASCII (Text) file named “702966_ST25.TXT,” created on May 7, 2008.BACKGROUND OF THE INVENTION[0003]Delivery of proteins as therapeutics or for inducing an immune response in biologically relevant amounts has been an obstacle to drug and vaccine development for decades. One solution that has proven to be a successful alternative to traditional drug delivery approaches is delivery of exogenous nucleic acid sequences for production of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N15/87C12N5/06
CPCC12N7/00C12N15/635C12N2830/006C12N2710/10343C12N2710/10352C12N15/86
InventorGALL, JASON G. D.BROUGH, DOUGLAS E.KING, C. RICHTER
OwnerGEN VEC INC