Unlock instant, AI-driven research and patent intelligence for your innovation.

Methods of using isolated recombinant polypeptide antagonists of sdf-1

a technology of sdf-1 and polypeptide, which is applied in the field of recombinant method of producing sdf-1 receptor antagonists and polynucleotide sequences encoding the antagonists, can solve the problems of high cost of producing them, and achieve the effect of decreasing the activity of an sdf-1 receptor

Inactive Publication Date: 2011-01-06
CHEN YONG +2
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The recombinant SDF-1 receptor antagonists effectively bind to SDF-1 receptors, inhibiting activities like interferon gamma production, hematopoietic cell proliferation, and solid tumor growth, offering therapeutic benefits in various diseases with improved cost-effectiveness.

Problems solved by technology

Unfortunately, as these analogs were produced using synthetic peptide synthesis, the cost of producing them was high and their activity could be improved, perhaps due to the structure (secondary, tertiary, and quaternary) of the peptide.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods of using isolated recombinant polypeptide antagonists of sdf-1
  • Methods of using isolated recombinant polypeptide antagonists of sdf-1
  • Methods of using isolated recombinant polypeptide antagonists of sdf-1

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0122]The expression vectors described herein can have a fusion tag (CBD-tag, Intein-tag, or GST-tag) at the N-terminal for affinity purification to produce a high purity of recombinant. Target recombinants can be released from fusion tags by a simple cleavage reaction mediated by factor Xa, enterokonese or cyanogen bromide, or a leading peptide self-release. A final recombinant can be produced without extra amino acids. In addition, a construct can be engineered for expression of SDF-1 mutants without any tagging, resulting in a final recombinant having, for example, one extra amino acid of Methionine at the N-terminal. The expression vectors developed using the methods taught herein were sequenced for final confirmation.

[0123]Prior to protein production, each recombinant is verified using tests that include Western-blotting, mass spectrometry, sequence identification, and assays of biological activity in the processing steps. The processing can include gene cloning, protein induct...

example 2

[0125]Cloning of rhSDF-1-P2G cDNA into a subclone vector: rhSDF-1alpha P2G DNA sequence (SEQ ID NO: 1) was designed, synthesized, and cloned into plasmid pUC57 with restriction enzyme EcoR V at two sites. The DNA sequence was confirmed by sequence analysis. PCR was used to clone the cDNA fragment encoding rhSDF-1 alpha P2G. Based on the N-terminal sequence of SEQ ID NOs: 4, 6, 8, and 10, the following specific primers were synthesized:

For SEQ ID NO: 4,primer 1:(SEQ ID NO: 23)acccatgggtcatcatcatcatcatcatgcggcaatgaagggcgtgagcctgtctta, forward;and,primer 2:(SEQ ID NO: 24)acaagcttgaattcctactatttgttcagcgc, reverse;For SEQ ID NO: 6,primer 3:(SEQ ID NO: 25)gaattcatcgaaggtcgtaaaccgg, forward;and,primer 4:(SEQ ID NO: 26)gcggccgcctactatttgttcagcgctttttc, reverse;For SEQ ID NO: 8,primer 5:(SEQ ID NO: 27)gagctcgaattcgatgatgatgataaaaaaccggtgagcct,forward;primer 6:(SEQ ID NO: 28)ctcgaggcggccgcctactatttgttcagcgctttttc, reverse;For SEQ ID NO: 10,primer 7:(SEQ ID NO: 29)atccatgggctagtaggcaatgaaaccgg...

example 3

[0127]Cloning of rhSDF-1alpha P2G cDNA into a Bacterial Expression Vector: rhSDF-1alpha P2G cDNA was prepared by subcloning with NcoI and EcoRI and insertion into a digested pET28a vector as described in Qin et al. (1997), supra, using standard methods. Right clones were verified by restriction enzyme digestion mapping, and the final construct was confirmed by DNA sequencing and alignment analysis. The rhSDF-1alpha P2G cDNA have also been cloned into pTugE07, pGEX4T1, pGEX4T2, pTYB11 and pET31b.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightsaaaaaaaaaa
molecular weightsaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

This invention is generally directed to a recombinant method of producing SDF-1 receptor antagonists. More particularly, the invention is directed to the isolated and / or recombinant polynucleotide sequences encoding analogs of human SDF-1 alpha or beta and, in particular, SDF-1 analogs having the proline at residue position number 2 replaced with a glycine to provide an SDF-1 receptor antagonist. The recombinant method can be used to produce drugs for a variety of therapeutic uses including, but not limited to, treatment of cancer, inhibiting angiogenesis, and hematopoietic cell proliferation.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application is a divisional of U.S. patent application Ser. No. 11 / 725,725, filed May 23, 2007, which is (i) a continuation-in-part of U.S. patent application Ser. No. 10 / 945,674, filed Sep. 20, 2004, which is a continuation of U.S. patent application Ser. No. 09 / 852,424, filed May 9, 2001, which claims the benefit of U.S. Provisional Application No. 60 / 205,467, filed May 19, 2000; wherein, U.S. patent application Ser. No. 10 / 945,674, filed Sep. 20, 2004, claims the benefit of Canadian Application No. 2305787, filed May 9, 2000;[0002](ii) a continuation-in-part of U.S. patent application Ser. No. 11 / 060,031, filed Feb. 16, 2005, which is a divisional of U.S. patent application Ser. No. 09 / 646,193, filed Mar. 26, 2002, which is a National Stage application of PCT Application No. PCT / CA99 / 00750, filed Aug. 16, 1999, which claims the benefit of Canadian Application No. 2245224, filed Aug. 14, 1998; and,[0003](iii) a continuation-in-part...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): A61K38/21A61K38/16A61P35/00C12N5/0783G06Q30/02
CPCA61K38/10A61K38/195A61K48/00G06Q30/02C07K14/522C12N2501/21C07K14/4703A61P35/00
Inventor CHEN, YONGFELDMAN, GLEBSALARI, HASSAN
Owner CHEN YONG