Methods of using isolated recombinant polypeptide antagonists of sdf-1
a technology of sdf-1 and polypeptide, which is applied in the field of recombinant method of producing sdf-1 receptor antagonists and polynucleotide sequences encoding the antagonists, can solve the problems of high cost of producing them, and achieve the effect of decreasing the activity of an sdf-1 receptor
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
[0122]The expression vectors described herein can have a fusion tag (CBD-tag, Intein-tag, or GST-tag) at the N-terminal for affinity purification to produce a high purity of recombinant. Target recombinants can be released from fusion tags by a simple cleavage reaction mediated by factor Xa, enterokonese or cyanogen bromide, or a leading peptide self-release. A final recombinant can be produced without extra amino acids. In addition, a construct can be engineered for expression of SDF-1 mutants without any tagging, resulting in a final recombinant having, for example, one extra amino acid of Methionine at the N-terminal. The expression vectors developed using the methods taught herein were sequenced for final confirmation.
[0123]Prior to protein production, each recombinant is verified using tests that include Western-blotting, mass spectrometry, sequence identification, and assays of biological activity in the processing steps. The processing can include gene cloning, protein induct...
example 2
[0125]Cloning of rhSDF-1-P2G cDNA into a subclone vector: rhSDF-1alpha P2G DNA sequence (SEQ ID NO: 1) was designed, synthesized, and cloned into plasmid pUC57 with restriction enzyme EcoR V at two sites. The DNA sequence was confirmed by sequence analysis. PCR was used to clone the cDNA fragment encoding rhSDF-1 alpha P2G. Based on the N-terminal sequence of SEQ ID NOs: 4, 6, 8, and 10, the following specific primers were synthesized:
For SEQ ID NO: 4,primer 1:(SEQ ID NO: 23)acccatgggtcatcatcatcatcatcatgcggcaatgaagggcgtgagcctgtctta, forward;and,primer 2:(SEQ ID NO: 24)acaagcttgaattcctactatttgttcagcgc, reverse;For SEQ ID NO: 6,primer 3:(SEQ ID NO: 25)gaattcatcgaaggtcgtaaaccgg, forward;and,primer 4:(SEQ ID NO: 26)gcggccgcctactatttgttcagcgctttttc, reverse;For SEQ ID NO: 8,primer 5:(SEQ ID NO: 27)gagctcgaattcgatgatgatgataaaaaaccggtgagcct,forward;primer 6:(SEQ ID NO: 28)ctcgaggcggccgcctactatttgttcagcgctttttc, reverse;For SEQ ID NO: 10,primer 7:(SEQ ID NO: 29)atccatgggctagtaggcaatgaaaccgg...
example 3
[0127]Cloning of rhSDF-1alpha P2G cDNA into a Bacterial Expression Vector: rhSDF-1alpha P2G cDNA was prepared by subcloning with NcoI and EcoRI and insertion into a digested pET28a vector as described in Qin et al. (1997), supra, using standard methods. Right clones were verified by restriction enzyme digestion mapping, and the final construct was confirmed by DNA sequencing and alignment analysis. The rhSDF-1alpha P2G cDNA have also been cloned into pTugE07, pGEX4T1, pGEX4T2, pTYB11 and pET31b.
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weights | aaaaa | aaaaa |
| molecular weights | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


