Encoding text into nucleic acid sequences

Inactive Publication Date: 2011-11-03
CODEX DNA INC
View PDF11 Cites 30 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0017]The present application is directed to generating an encoding scheme configured to translate human readable symbols into codon identifiers (i.e., discrete sequences of preferably three elements, where each element contains one of four selected nucleotide bases). In this manner, sequences of human readable symbols can be used to convey non-genetic messages (for example, text messages, trademarks, copyright notices, unique identifying information, etc.) by encoding the message into sequences of codon identifiers. These sequences of codon identifiers may then be used to generate synthetic nucleic acid sequences that are introduced into a living cell or organism as free DNA or incorporated into other various types of cellular nucleic acid materials (e.g., plasmids, chromosomes, mitochondrial DNA, genomes, etc.). The resulting set of codons or codon identifiers effectively serves as a memory source for the encoded sequences of human readable symbols.
[0018]Unlike conventional methods of encoding such nucleic acid sequences, embodiments described herein utilize an encoding scheme with a remarkably low probability of biological impact. That is to say, a low probability exists that a synthetic nucleic acid sequence created using invention methods and schemes will be transcribed or translated by a cell's internal biological processes. As a result, the non-genetic message created using invention methods and schemes may be innocuously carried and replicated by cells comprising the message, but may be decoded to provide the human readable symbols, i.e., the message carried therein. Advance knowledge of a gene's structure and / or function is not required in order to decode a given sequence of nucleotides. This greatly simplifies the decoding process, enabling a message recipient to decode one or more messages using a simple human readable symbol map.
[0019]Also, since the encoding scheme is configured to translate each human readable symbol of an input message into a three-nucleotide codon identifier, efficiency gains are realized over many conventional encoding systems. Therefore, significantly less storage space is required to store an encoded message, both within a cell or a cell within an organism, and within the transcoder itself or the memory of the transcoder itself.

Problems solved by technology

Unfortunately, conventional encoding schemes suffer from a one of two serious drawbacks, either they run the risk of causing a negative biological impact on a cell harboring nucleic acid sequences made using such encoding schemes, or they rely upon codon-redundancy in a carrier-gene of known function.
Methods using a carrier-gene are characterized by extreme inefficiency of encoded information and are further limited by their requirement of encoding a message inside a carrier gene of known sequence and limited length.
This imposes a limit on the length of the message that can be encoded that is further exacerbated by the inefficiency of the encoding scheme.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Encoding text into nucleic acid sequences
  • Encoding text into nucleic acid sequences
  • Encoding text into nucleic acid sequences

Examples

Experimental program
Comparison scheme
Effect test

example 1

Encoding Methods

[0234]FIGS. 3 and 8 identify codon identifiers and the respective symbols encoded therefrom. By virtue of the design of the non-genetic message or watermark, the encoded text does not correspond to the sequences of a gene or other biologically active sequence when in the form of a nucleic acid in the cell or organism. The examples provided in the Figures encode all letters in the American English alphabet as well as all 10 numerals and common punctuation marks.

[0235]While the present Figures and Examples are described with respect to the English language, one would comprehend that the coding scheme can be adapted to any reference language as described above.

[0236]An encoded non-genetic message in the nucleic acid sequence is flanked by the sequence 5′-TTAACTAGCTAA-3′ (SEQ ID NO: 1) on both the 5′ and 3′ sides of the watermark since that sequence contains a stop codon in all 6 reading frames.

[0237]To encode a non-genetic message or watermark, one can substitutes in a ...

example 2

Decoding Methods

[0243]To decode a watermark one performs the same process as encoding as described in Example 1, but in reverse.

[0244]One substitutes in a serial one-to-one manner, each successive three nucleotides of the watermark for their respective human readable symbols of human readable text. These substitutions (performed either by hand or by a computer program) are made such that each human readable symbol is placed to the right of the preceding symbol as one substitutes along the watermark in a 5′ to 3′ direction. This is process of substitution is performed after the sequence 5′-TTAACTAGCTAA-3′ (SEQ ID NO: 1) is removed from both ends of the watermark.

[0245]For example, to decode the sequence 5′-TTAACTAGCTAAGTTTTTTTGCTGCCCGCTTGACTATAGCTGTGCATATCTCTTAC TCGAAATATATAGAACAACATACTACTGTACTCATGAGCTATACTATAAGCTTAA CTATTGTAAATTGTGATAACTTCTTCTGTACGATTAACTAGCTAA-3′ (SEQ ID NO: 9), the first step removes the sequence 5′-TTAACTAGCTAA-3′ (SEQ ID NO: 1) from both ends of the watermark le...

example 3

Synthetic Cells Containing Watermarks

[0251]A 1.08 Mbp Mycoplasma mycoides genome was chemically synthesized, and assembled in yeast as a centromeric plasmid; the genome was isolated as naked DNA and transplanted into Mycoplasma capricolum to create a new bacterial cell controlled only by the synthetic genome.

[0252]Described in International Patent Application PCT / US10 / 35490 is the design, synthesis and assembly of the 1,077,947-bp Mycoplasma mycoides JCVI-syn1 genome from 1,078 1-kb synthetic DNA cassettes. The assembly was facilitated by in vitro and in vivo assembly methods. Cassettes in sets of ten were assembled by yeast recombination and propagated in a yeast / Escherichia coli shuttle vector. The 10-kb assemblies were recombined in sets of ten to produce 100-kb assemblies. The resulting eleven 100-kb assemblies were recombined in a single final step into the complete genome. A yeast clone bearing the synthetic genome was selected and confirmed by multiplex PCR and restriction an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Biological propertiesaaaaaaaaaa
Nucleic acid sequenceaaaaaaaaaa
Login to View More

Abstract

Methods and apparatus are disclosed herein for encoding human readable text conveying a non-genetic message into nucleic acid sequences with a substantially reduced probability of biological impact and decoding such text from nucleic acid sequences. In one embodiment, each symbol of a symbol set of human readable symbols uniquely maps to a respective codon identifier. Mapping may ensure that each symbol will not map to a codon identifier that generates an amino acid residue which has a single-letter abbreviation that is the equivalent to the respective symbol. Synthetic nucleic acid sequences comprising such human readable text, and recombinant or synthetic cells comprising such sequences are provided, as well as methods of identifying cells, organisms, or samples containing such sequences.

Description

CROSS-REFERENCES TO RELATED APPLICATIONS[0001]This application claims benefit of U.S. provisional patent application 61 / 256,913, filed Oct. 30, 2009, and to U.S. application Ser. No. 12 / 783,489, filed May 19, 2010, each of which is incorporated by reference in its entirety.FIELD OF THE INVENTION[0002]The presently disclosed application relates generally to the field of molecular biology. More specifically, this application relates to synthetic nucleic acid sequences comprising non-genetic information.REFERENCE TO SEQUENCE LISTING[0003]This application contains references to amino acid sequences and / or nucleic acid sequences which have been submitted concurrently herewith as the sequence listing text file “SGI1450-1_ST25.txt”, file size 09.02 KiloBytes (KB), created on Oct. 29, 2010. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. §1.52(e)(5).BACKGROUND OF THE INVENTION[0004]Biological organisms comprise nucleic acid seque...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N1/21C12N1/00C12N7/01G06F17/30C12N1/13C12N5/10C12N1/15C07H21/00C12N15/63C12N1/19
CPCC12Q1/6806C12Q2563/185G06F16/86C12Q1/68G16B30/00
InventorHUTCHISON, CLYDE A.MONTAGUE, MICHAEL G.SMITH, HAMILTON O.
OwnerCODEX DNA INC