Plants Having Enhanced Yield-Related Traits and a Method for Making the Same

a technology of yield-related traits and plants, which is applied in the field of plants having enhanced yield-related traits and a method for making the same, can solve the problems of abnormal flowers, reduced flowering time, delayed flowering, etc., and achieves the effect of increasing yield and enhancing yield-related traits

Inactive Publication Date: 2013-12-05
BASF PLANT SCI GMBH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patent describes a method for introducing a new gene into a plant's genome using homologous recombination. The new gene is introduced into a specific region that controls its natural expression in the plant. The method allows for the preferential expression of the new gene in the plant's shoots, specifically in the expanding tissues. The patent also provides genetic constructs and vectors to facilitate the introduction and expression of the new gene in shoots. The technical effect of the invention is a more targeted and effective way to modify the genome of plants for research and agricultural purposes.

Problems solved by technology

Ectopic expression of AP1 results in a decrease of flowering time, and AP1 mutants exhibit delayed flowering and have abnormal flowers.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plants Having Enhanced Yield-Related Traits and a Method for Making the Same
  • Plants Having Enhanced Yield-Related Traits and a Method for Making the Same
  • Plants Having Enhanced Yield-Related Traits and a Method for Making the Same

Examples

Experimental program
Comparison scheme
Effect test

example 1

Identification of Sequences Related to the Nucleic Acid Sequence Used in the Methods of the Invention

[0724]Sequences (full length cDNA, ESTs or genomic) related to the nucleic acid sequence used in the methods of the present invention were identified amongst those maintained in the Entrez Nucleotides database at the National Center for Biotechnology Information (NCBI) using database sequence search tools, such as the Basic Local Alignment Tool (BLAST) (Altschul et al. (1990) J. Mol. Biol. 215:403-410; and Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402). The program is used to find regions of local similarity between sequences by comparing nucleic acid or polypeptide sequences to sequence databases and by calculating the statistical significance of matches. For example, the polypeptide encoded by the nucleic acid of the present invention was used for the TBLASTN algorithm, with default settings and the filter to ignore low complexity sequences set off. The output of the analy...

example 2

Cloning of the Nucleic Acid Sequence Used in the Methods of the Invention

[0727]The nucleic acid sequence used in the methods of the invention was amplified by PCR using as template a custom-made Arabidopsis thaliana seedlings cDNA library (in pCMV Sport 6.0; Invitrogen, Paisley, UK). PCR was performed using Hifi Taq DNA polymerase in standard conditions, using 200 ng of template in a 50 μl PCR mix. The primers used were prm00957 (SEQ ID NO: 3; sense, start codon in bold:

5′ aaaaagcaggctcacaatggagaatgggaaaagagac 3′)

and prm00958 (SEQ ID NO: 4; reverse, complementary,:

5′ agaaagctgggttggttttaactagttccaccg 3′),

which include the AttB sites for Gateway recombination. The amplified PCR fragment was purified also using standard methods. The first step of the Gateway procedure, the BP reaction, was then performed, during which the PCR fragment recombines in vivo with the pDONR201 plasmid to produce, according to the Gateway terminology, an “entry clone”, pHAL3. Plasmid pDONR201 was purchased f...

example 3

Expression Vector Construction

[0728]The entry clone pHAL3 was subsequently used in an LR reaction with pEXP, a destination vector used for Oryza sativa transformation. This vector contains as functional elements within the T-DNA borders: a plant selectable marker; a screenable marker expression cassette; and a Gateway cassette intended for LR in vivo recombination with the nucleic acid sequence of interest already cloned in the entry clone. A rice beta expansin promoter (SEQ ID NO: 5) for shoot-specific expression was located upstream of this Gateway cassette.

[0729]After the LR recombination step, the resulting expression vector pEXP::HAL3 (FIG. 2) was transformed into Agrobacterium strain LBA4044 and subsequently to Oryza sativa plants.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Tmaaaaaaaaaa
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
Login to View More

Abstract

The present invention relates generally to the field of molecular biology and concerns a method for improving various plant growth characteristics by modulating expression in a plant of a nucleic acid encoding a GRP (Growth-Related Protein), specifically a nucleic acid encoding a HAL3 polypeptide, a nucleic acid encoding a MADS15 polypeptide, a nucleic acid encoding a PLT transcription factor polypeptide, a nucleic acid encoding a Squamosa promoter binding protein-like 15 (SPL15) transcription factor polypeptide or a nucleic acid encoding a basic / helix-loop-helix (bHLH) transcription factor. The present invention also concerns plants having modulated expression of a nucleic acid encoding a GRP, which plants have improved growth characteristics relative to corresponding wild type plants or other control plants. The invention also provides constructs useful in the methods of the invention.

Description

RELATED APPLICATIONS[0001]The present application is a continuation of U.S. patent application Ser. No. 12 / 294,983 filed on Sep. 29, 2008, which is a national stage application (under 35 U.S.C. 371) of PCT / EP2007 / 053081, filed Mar. 30, 2007, which claims benefit of European applications 06075822.4, filed Mar. 31, 2006; 06075823.2, filed Mar. 31, 2006; 06075918.0, filed Apr. 10, 2006; 06075957.8, filed Apr. 27, 2006; 06114140.4, filed May 18, 2006; 06117235.9, filed Jul. 14, 2006 and 07100833.8, filed Jan. 19, 2007 and U.S. Provisional applications 60 / 790,151, filed Apr. 7, 2006; 60 / 790,116, filed Apr. 7, 2006; 60 / 792,225, filed Apr. 14, 2006; 60 / 798,602, filed May 8, 2006; 60 / 801,687, filed May 19, 2006 and 60 / 889,958, filed Feb. 15, 2007. The entire contents of each of these applications are hereby incorporated by reference herein.SUBMISSION OF SEQUENCE LISTING[0002]The Sequence Listing associated with this application is filed in electronic format via EFS-Web and hereby incorporat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N15/82
CPCC12N15/8242C07K14/415C12N15/8261Y02A40/146
InventorREUZEAU, CHRISTOPHEFRANKARD, VALERIESANZ MOLINERO, ANA ISABEL
OwnerBASF PLANT SCI GMBH