Antigen delivery platforms

a technology of antigens and platforms, applied in the direction of viruses, drug compositions, immunological disorders, etc., can solve the problems of devastating defects in neurological development in neonates, substantial morbidity and mortality, and substantial morbidity and mortality, and achieve the effect of inhibiting the entry of cmv

Inactive Publication Date: 2014-01-30
GLAXOSMITHKLINE BIOLOGICALS SA
View PDF8 Cites 66 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The invention relates to self-replicating RNA molecules that can contain modified nucleotides, which improve their stability and resistance to degradation in vivo. These modified molecules are also less likely to stimulate the immune system, which makes them safer and more efficient for use in cells. This allows for effective amplification and expression of protein, as well as adjuvant effects. Overall, this invention provides a better way to produce and utilize RNA molecules for research and therapeutic purposes.

Problems solved by technology

Herpes viruses are widespread and cause a wide range of diseases in humans that in the worst cases can lead to substantial morbidity and mortality, primarily in immunocompromised individuals (e.g., transplant recipients and HIV-infected individuals).
CMV infection leads to substantial morbidity and mortality in immunocompromised individuals (e.g., transplant recipients and HIV-infected individuals) and congenital infection can result in devastating defects in neurological development in neonates.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antigen delivery platforms
  • Antigen delivery platforms
  • Antigen delivery platforms

Examples

Experimental program
Comparison scheme
Effect test

example 1

Delivery of Individual CMV Antigens Using a VRP Platform

[0211]Each of CMV glycoproteins gB and gH induce neutralizing responses, and gB is the dominant antigen among antibodies in human sera that neutralize infection of fibroblasts (Britt et al. (1990) J. Virol. 64(3):1079-85). The following experiments demonstrate in mice a neutralizing response against these antigens delivered using a VRP platform.

[0212]Each CMV antigen was cloned into a pcDNA-6H is vector (Invitrogen) and tested for protein expression before cloning into an alphavirus replicon vector, pVCR 2.1 SalI / XbaI derived from the plasmid described by Perri et al. (J. Virol 77(19)10394-10403 (2003)) producing the constructs shown in FIG. 2. pVCR 2.1 SalI / XbaI is a self-replicating RNA vector that, when electroporated with defective helper capsid and glycoprotein RNA, forms an infectious alphavirus particle.

[0213]pVCR vectors were used to make RNA which was electroporated into baby hamster kidney (BHKV) cells in the presence...

example 2

Construction of Polycistronic Alphavirus Vectors

[0219]CMV produces several multi-protein complexes during infection. To determine whether a single replicon expressing all components of a desired complex can be used to produce the CMV complex in a subject, or whether components of the complex could be co-delivered from multiple replicon vectors, we designed a platform that allows controlled expression of multiple CMV proteins.

[0220]An alphavirus vector (pVCR 2.1 SalI / XbaI) was modified to allow assembly of multiple subgenomic promoters (SGP) and genes of interest (GOI). pVCR 2.1SalI / XbaI ApaI site at 11026-31 bp was changed from GGGCCC (SEQ ID NO:______) to GGCGCC (SEQ ID NO:______). ClaI and PmlI restriction sites added in the region immediately downstream of the first subgenomic promoter and SalI-XbaI insert sites. The sequence at 7727-7754 bp was changed from ctcgatgtacttccgaggaactgatgtg (SEQ ID NO:______) to ATCGATGTACTTCCGAGGAACTCACGTG (SEQ ID NO:______).

[0221]A shuttling vector...

example 3

Production of CMV Complexes

[0232]This example demonstrates that CMV protein complexes can be formed in a cell after delivery of the complex components from a polycistronic alphavirus replicon vector.

[0233]gH / gL and gH / gL / gO Complexes

[0234]Polycistronic gH / gL and gH / gL / gO alphavirus replicons were constructed as described above (shown schematically in FIG. 5A). VRPs containing gH, gL, gO, gH / gL and gH / gL / gO encoding replicons were produced in BHKV cells as described above and used to infect BHKV cells to demonstrate complex formation in vitro. VRP infected ARPE-19 cells produced disulfide linked complexes of gH / gL. gO did not detectably alter gH / gL association (FIG. 5B).

[0235]Immunofluorescence studies were conducted to evaluate the localization of gH and gL delivered alone and when delivered using a polycistronic alphavirus to look at relocalization of the proteins when co-expressed. gH localization did not appear to change in the presence or absence of gL, or gL / gO. gL localization...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Currentaaaaaaaaaa
Massaaaaaaaaaa
Massaaaaaaaaaa
Login to View More

Abstract

This disclosure provides platforms for delivery of herpes virus proteins to cells, particularly proteins that form complexes in vivo. In some embodiments these proteins and the complexes they form elicit potent neutralizing antibodies. Thus, presentation of herpes virus proteins using the disclosed platforms permits the generation of broad and potent immune responses useful for vaccine development.

Description

RELATED APPLICATION[0001]This application claims the benefit of U.S. Provisional Patent Application No. 61 / 391,960, filed on Oct. 11, 2010, the entire teachings of which are incorporated herein by reference.BACKGROUND[0002]Herpes viruses are widespread and cause a wide range of diseases in humans that in the worst cases can lead to substantial morbidity and mortality, primarily in immunocompromised individuals (e.g., transplant recipients and HIV-infected individuals). Humans are susceptible to infection by at least eight herpes viruses. Herpes simplex virus-1 (HSV-1, HHV-1), Herpes simplex virus-2 (HSV-2, HHV-2) and Varicella zoster virus (VZV, HHV-3) are alpha-subfamily viruses, cytomegalovirus (CMV, HHV-5) and Roseoloviruses (HHV-6 and HHV-7) are beta-subfamily viruses, Epstein-Barr virus (EBV, HHV-4) and Kaposi's sarcoma-associated herpesvirus (KSHV, HHV-8) are gamma-subfamily viruses that infect humans.[0003]CMV infection leads to substantial morbidity and mortality in immunoco...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/005C12N15/86
CPCC12N15/86C07K14/005A61K39/12A61K2039/53C07K2319/92C12N2710/16122C12N2710/16134C12N2710/16722C12N2710/16734C12N2770/36143C12N2830/20C12N2840/203A61K2039/5256A61K2039/55555A61P31/22A61P37/04
InventorFRANTI, MICHAELLILJA, ANDERSLOOMIS, REBECCAMASON, PETER
OwnerGLAXOSMITHKLINE BIOLOGICALS SA