Introducing DNA into plant cells

a plant cell and dna technology, applied in the field of plant molecular biology, can solve the problems of difficult and time-consuming transformation of some agriculturally important crop plants, poor efficiency of transformation, and serious genotype limitations, and achieve the effect of simple and efficient delivery of heterologous dna and easy growth

Inactive Publication Date: 2015-08-20
YISSUM RES DEV CO OF THE HEBREW UNIV OF JERUSALEM LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This approach allows for simple, efficient, and fast introduction of heterologous DNA into plant seeds, facilitating the growth of mature plants without regeneration cultures, while avoiding genetic modification concerns and improving traits like stress tolerance and product synthesis.

Problems solved by technology

However, in many major crop plants, serious genotype limitations still exist.
Transformation of some agriculturally important crop plants continues to be both difficult and time consuming.
In addition, in all the aforementioned technologies, transformation is conducted with vegetative tissues (including embryos) the efficiency of transformation is poor, markers for selection are required, and the percentage of successful regeneration of a plant from the transformed cell or tissue is rather low.
Integration of the foreign DNA into the plant genome is not always desirable, particularly when genetically modified (GMO) plants arouse environmental and political issues.
The amount of water absorbed (with or without beneficial chemicals) must be carefully controlled, as too much would simply allow the seed to germinate and too little would result in the seed ageing.
As described hereinabove, the available methods have limitations with regard to applicability and efficacy.
In addition integration of the foreign DNA to the plant genome is not always desirable.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Introducing DNA into plant cells
  • Introducing DNA into plant cells
  • Introducing DNA into plant cells

Examples

Experimental program
Comparison scheme
Effect test

example 1

Priming Using a Priming Medium Without Foreign DNA

[0111]Tomato seed priming in the presence of polyethylene glycol (PEG) was carried out as previously described (Khan, A A. 1992. In: Horticultural Reviews, Vol. 14, ed. J. Janick. New York: John Wiley, pp. 131-181; Taylor G. et al. 1998. Seed Science Technology 8:245-256), with some modifications.

[0112]Batches of 50 tomato seeds were imbibed in a solution composed of 0.1M Ca(NO3)2; 0.1M MES (4-morpholineetahnsulfonic acid); 15 mM MgCl2 and 25% (solution T2) or 20% (solution T3) of PEG 8000. The osmotic pressure of solutions T2 and T3 was −1.25 mPa and −1.2 mPa respectively. Untreated dry seeds of the same cultivar, same seed lot were used as control. Treatment was carried out under constant temperature of 20° C. with a 12 hour light regimen daily, and stirred gently for 4 or 6 days to obtain proper aeration. Seeds were then placed on 3M filter paper supplemented with 3 ml sterile water and germination rates were recorded daily. The d...

example 2

Introducing IL-60 Constructs into Seeds by Using Priming Medium

[0113]Tomato seeds were primed with a priming solution containing 25% PEG and germinated as described in Example 1 above in the presence of 20, 40 and 60 μg of each of the IL-60-BS (SEQ ID NO:2) and pIR-GUS (SEQ ID NO:8) DNA constructs. The constructs are illustrated in FIGS. 2A and 2B, respectively. Constructs are also described in US Patent Application No. 20100071088, incorporated herein by reference. Untreated dry seeds and seeds primed at the same conditions but without the DNA construct served as control.

[0114]Six days after germination the seedlings were transplanted into pots containing 10 liters soil and placed in a greenhouse at 25° C. Twenty one days after planting, DNA was extracted from true leaves (the third true leaf or above) and subjected to PCR with the following primers for GUS assay:

[0115]Forward primer: ATTGATCAGCGTTGGTGGGA (SEQ ID NO:6) and reverse primer: TGCGGTCGCGAGTGAAGATC (SEQ ID NO:7) designed...

example 3

Expression of the Foreign Genes

[0116]The DNA constructs of the IL-60 family as detailed in Example 2 above (IL-60-BS in combination with pIR-GUS) facilitated the expression of the foreign gus gene present within the pIR-GUS DNA construct and introduced via priming.

[0117]Tomato leaves from the plant obtained as described in Example 2 above were stained for beta-glucuronidase (GUS) according to Jefferson R A. et al. (1987. EMBO J 6: 3901-3907).

[0118]Blue color staining of the leaf tissue clearly denotes the expression of the GUS protein (FIG. 4A-B).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides means and methods for simple and efficient introduction of foreign genetic material into the plant cell. Particularly, the present invention combines seed priming and virus-based DNA constructs for efficient introduction of heterologous DNA into plants.

Description

RELATED APPLICATIONS[0001]This application is a continuation of U.S. patent application Ser. No. 13 / 381,103 filed on Feb. 23, 2012, which is a National Phase of PCT Patent Application No. PCT / IL2010 / 000526 having International filing date of Jun. 30, 2010, which claims the benefit of priority of U.S. Provisional Patent Application Nos. 61 / 287,435 filed on Dec. 17, 2009, and 61 / 221,626 filed on Jun. 30, 2009. The contents of the above applications are all incorporated herein by reference.FIELD OF THE INVENTION[0002]The present invention relates to the field of plant molecular biology, particularly to means and methods for simple and efficient introduction of exogenous genetic material into the plant cell.BACKGROUND OF THE INVENTION[0003]Plants carrying one or more expressible heterologous genes have a variety of potential advantages. The plants carrying a gene expression cassette may carry one or more genes which confer desired traits, including for example, herbicide, pesticide or i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N15/82
CPCC12N15/8257Y02A40/146C12N15/8203C12N15/8261
InventorSELA, ILANRABINOWITCH, HAIM DAVIDGOVER, OFER
OwnerYISSUM RES DEV CO OF THE HEBREW UNIV OF JERUSALEM LTD