DNA encoding tumor necrosis factor- alpha and - beta receptors

a tumor necrosis factor and receptor technology, applied in the field ofcytokine receptors, can solve the problems of lack of suitable sources, tnf-r molecule, tnf-r, etc., and achieve the effect of tnf-r molecules, and facilitating the synthesis of tnf-r

Inactive Publication Date: 2000-06-27
IMMUNEX CORP
View PDF29 Cites 98 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Such compositions, however, are obtainable in practical yields only by cloning and expressing genes encoding the receptors using recombinant DNA technology.
.Iadd.Efforts .Iaddend.to purify the TNF-R molecule for use in biochemical analysis or to clone and express mammalian genes encoding TNF-R, however, have been impeded by lack of a suitable source of receptor protein or mRNA.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

example 1

Binding Assays

A. Radiolabeling of TNF.alpha. and TNF.beta.. Recombinant human TNF.alpha., in the form of a fusion protein containing a hydrophilic octapeptide at the N-terminus, was expressed in yeast as a secreted protein and purified by affinity chromatography (Hopp et al., Bio / Technology 6:1204, 1988). Purified recombinant human TNF.beta. was purchased from R&D Systems (Minneapolis, Minn.). Both proteins were radiolabeled using the commercially available solid phase agent, IODO-GEN (Pierce). In this procedure, 5 .mu.g of IODO-GEN were plated at the bottom of a 10.times.75 mm glass tube and incubated for 20 minutes at 4.degree. C. with 75 .mu.l of 0.1M sodium phosphate, pH 7.4 and 20 .mu.l (2 mCi) Na .sup.125 I. This solution was then transferred to a second glass tube containing 5 .mu.g TNF.alpha. (or TNF.beta.) in 45 .mu.l PBS for 20 minutes at 4.degree. C. The reaction mixture was fractionated by gel filtration on a 2 ml bed volume of Sephadex G-25 (Sigma) equilibrated in Roswe...

example 2

Isolation of Human TNF-R cDNA by Direct Expression of Active Protein in COS-7 Cells

Various human cell lines were screened for expression of TNF-R based on their ability to bind .sup.125 I-labeled TNF. The human fibroblast cell line WI-26 VA4 was found to express a reasonable number of receptors per cell. Equilibrium binding studies showed that the cell line exhibited biphasic binding of .sup.125 I-TNF with approximately 4,000 high affinity sites (K.sub.a =1.times.10.sup.10 M.sup.-1) and 15,00 low affinity sites (K.sub.a =1.times.10.sup.8 M.sup.-1) per cell.

An unsized cDNA library was constructed by reverse transcription of polyadenylated mRNA isolated from total RNA extracted from human fibroblast WI-26 VA4 cells grown in the presence of pokeweed mitogen using standard techniques (Gubler, et al., Gene 25:263, 1983; Ausubel et al., eds., Current Protocols in Molecular Biology, Vol. 1, 1987). The cells were harvested by lysing the cells in a guanidine hydrochloride solution and total ...

example 3

Construction of cDNAs Encoding Soluble huTNF-R.DELTA.235

A cDNA encoding a soluble huTNF-R.DELTA.235 (having the sequence of amino acids 1-235 of .[.FIG. 2A.]. .Iadd.SEQ ID NO:1.Iaddend.) was constructed by excising an 840 bp fragment from pCAV / NOT-TNF-R with the restriction enzymes Not1 and Pvu2. Not1 cuts at the multiple cloning site of pCAV / NOT-TNF-R and Pvu2 cuts within the TNF-R coding region 20 nucleotides 5' of the transmembrane region. In order to reconstruct the 3' end of the TNF-R sequences, two oligonucleotides .Iadd.(encoding amino acids corresponding to Ala.sup.229 -Asp.sup.235 of SEQ ID NO:1) .Iaddend.were synthesized and annealed to create the following oligonucleotide linker:

Pvu2 BamH1 Bgl2 CTGAAGGGAGCACTGGCGACTAAGGATCCA GACTTCCCTCGTGACCGCTGATTCCTAGGTCTAG AlaGluGlySerThrGlyAspEnd

This oligonucleotide linker has terminal Pvu2 and Bgl2 restriction sites, regenerates 20 nucleotides of the TNF-R, followed by a termination codon (underlined) and a BamH1 restriction site (fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
apparent molecular massaaaaaaaaaa
apparent molecular massaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

Tumor necrosis factor receptor DNAs and expression vectors encoding TNF receptors, and processes for producing TNF receptors as products of recombinant cell culture, are disclosed.

Description

BACKGROUND OF THE INVENTIONThe present invention relates generally to cytokine receptors and more specifically to tumor necrosis factor receptors.Tumor necrosis factor-.alpha. (TNF.alpha., also known as cachectin) and tumor necrosis factor-.beta. (TNF.beta., also known as lymphotoxin) are homologous mammalian endogenous secretory proteins capable of inducing a wide variety of effects on a large number of cell types. The great similarities in the structural and functional characteristics of these two cytokines have resulted in their collective description as "TNF." Complementary cDNA clones encoding TNF.alpha. (Pennica et al., Nature 312:724, 1984) and TNF.beta. (Gray et al., Nature 312:721, 1984) have been isolated, permitting further structural and biological characterization of TNF.TNF proteins initiate their biological effect on cells by binding to specific TNF receptor (TNF-R) proteins expressed on the plasma membrane of a TNF-responsive cell. TNF.alpha. and TNF-.beta. were firs...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(United States)
IPC IPC(8): C07K14/435C07K14/715A61K38/00C07K16/28C12N15/12
CPCC07K14/7151A61K38/00
InventorSMITH, CRAIG A.GOODWIN, RAYMOND G.BECKMANN, M. PATRICIA
OwnerIMMUNEX CORP