Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit

A nucleic acid sequence, red fire ant technology, applied in the field of molecular biology, can solve the problems of time-consuming and difficult to fully guarantee the accuracy, and achieve the effect of eliminating experimental operation errors, small sample volume, and strict inspection standards.

Inactive Publication Date: 2008-07-16
SUN YAT SEN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition to the fact that the accuracy is difficult to fully guarantee, and it takes a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit
  • Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit
  • Method of identifying invasion of south American glim ant and its nucleic acid sequence, probe and reagent kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Preparation of invasive South American red fire ants rDNA spacer (ITS region) nucleic acid sequence

[0040] Take a specimen of RIFA preserved by soaking in alcohol and put it into a 1.5ml centrifuge tube. Cooled with a small amount of liquid nitrogen, frozen and brittle. Grind slightly to crush the sample. Add 500ul extraction buffer (20mM Tris-Cl pH 8.0, 20mM EDTA pH 8.0, 400mM NaCl, 1% SDS), proteinase K (20mg / ml) 10ul. Incubate at 55°C and digest with shaking (750rpm) for more than 5 hours. Extraction with phenol:chloroform:isoamyl alcohol (25:24:1). Ethanol precipitation overnight. Redissolve with appropriate amount of TE to obtain the total DNA of RIFA invading South America.

[0041] Then carry out the PCR of ITS region, the primers used are respectively LH2 (5'CGTAGGTGAACCTGCGGAAGGATC 3') and Sm73 (5'TTCGCTCGCCGTTACTAGGGGAATC 3'). Take a 200ul PCR tube, add 20ul PCR reaction solution (which contains 2.0mM MgCl 2 , 200uM dNTP, 10×Taq DNA buffer 2...

Embodiment 2

[0042] Design and preparation of embodiment 2 specificity probe

[0043] On the basis of obtaining the nucleic acid sequence of the rDNA spacer of the invasive South American red imported fire ants, it was aligned and compared with the homologous sequences of other ant species, and a specific Probes (oligonucleotide fragments) with good properties. According to the sequence of the oligonucleotide fragments, chemical synthesis was carried out on a commercial DNA synthesizer. Five types of nucleic acid molecular probes were synthesized, as follows:

[0044] In244F: 5'ATCTTGGTGGAATTGACGAC 3'

[0045] In434F: 5'GACGGGAGGGAAGAAAAGAC 3'

[0046] In756F: 5'TGCTTAGCACGCTGGGAT 3'

[0047] In862R: 5'AGAGACCGCCGAGAAGTGC 3'

[0048] In1567R: 5' ACAACCGCGAGAGGGACTAT 3'.

[0049] The schematic diagram of the mutual position and direction relationship of the specific probe and PCR-specific primer combination in the ITS region DNA sequence of the invasive South American red imported fir...

Embodiment 3

[0051] The identification (conventional PCR method) of embodiment 3 invading South American red fire ants

[0052] 1. Extraction of total DNA from the sample.

[0053] Take one of each ant sample to be tested and put it into a 1.5ml centrifuge tube respectively. Add a small amount of liquid nitrogen to cool, freeze and crisp. Grind slightly to crush the sample. Add 500ul extraction buffer (20mM Tris-Cl pH 8.0, 20mM EDTA pH 8.0, 400mM NaCl, 1% SDS), proteinase K (20mg / ml) 10ul. Incubate at 55°C and digest with shaking (750rpm) for more than 5 hours. Extraction with phenol:chloroform:isoamyl alcohol (25:24:1). Ethanol precipitation overnight. Redissolve with an appropriate amount of TE to obtain the total DNA of the sample to be tested.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses method of identifying invading South American glim ant and its nucleic acid sequence, probe and reagent kit. The present invention provides full length nucleic acid sequence of rDNA transcription spacer of South American glim ant and several specific DNA molecular probes originating from the sequence. Using the serial specific molecular probes can detect and identify invading South American glim ant quickly and accurately. The present invention may be used in custom quarantine, imported flower detection, early warning, control, etc. on South American glim ant.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a method for rapidly detecting alien invasion of South American red fire ants by using molecular biology methods and the specific nucleic acid sequence, probe and kit used therein. Background technique [0002] On January 17, 2005, the Ministry of Agriculture listed the invasive South American red imported fire ants as my country's imported plant quarantine pests and national plant quarantine pests. At present, the epidemic has occurred in some areas such as Wuchuan and Shenzhen in Guangdong Province. In order to prevent the spread of the epidemic, the General Administration of Quality Supervision, Inspection and Quarantine attached great importance to it and issued an urgent notice requiring inspection and quarantine agencies to strengthen quarantine work. [0003] According to the report of the Agricultural Plant Quarantine Department, the Red Imported Fire Ant (RIFA, Solenops...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68
Inventor屈良鹄袁洁周惠王莹庞虹陈月琴
OwnerSUN YAT SEN UNIV