Reaction method

A reaction and reaction tank technology, applied in the field of reaction, can solve the problems of fragmentation and wear, limited application range, large bed pressure drop, etc., and achieve the effects of avoiding fragmentation and wear, simple replacement steps, and improved reaction speed

Active Publication Date: 2012-07-18
BIORIGHT WORLDWIDE
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] As far as the reaction method using a packed bed reactor is concerned, the existing problems are: [1] The exchange efficiency between the substrate and the solid-phase catalyst is low; [2] The reaction process is not easy to feed and gas, and it is not easy to adjust pH value and temperature, etc.; [3] Not suitable for viscous or insoluble substrates; [4] When using a solid-phase catalyst with small particles, the bed pressure drop is large, which leads to easy clogging
[0007] As far as the reaction method using a stirred reactor is concerned, although it can adjust various reaction conditions as required, in the process of stirring the stirring paddle, since the solid-phase catalyst is suspended in the substrate solution in the reaction tank, Strong collisions will occur between the solid phase catalyst particles, between the solid phase catalyst particles and the stirring paddle, and between the solid phase catalyst particles and the reaction tank wall (Enzymology, edited by Chen Shigen and Zhou Runqi, Fudan University Press, Shanghai , 2001; Biological Reaction Engineering, edited by Qi Yizheng and Xia Jie, Chemical Industry Press, Beijing, 2004), which leads to the fragmentation and wear of solid-phase catalyst particles due to collisions, thereby reducing the activity of solid-phase catalysts and reducing the use of The life is shortened, and the solid phase catalyst will produce fragments or slag due to fragmentation and wear, and these fragments or slag will be lost with the progress of the reaction, which will hinder the subsequent treatment of the reaction liquid, such as filtration and purification of the product, etc.
Moreover, it is well known that the greater the density and the faster the movement (rotational speed) of the solid-phase catalyst particles suspended in the solution, the higher the efficiency of the reaction; The more easily the catalyst fragments, the faster its activity declines
Therefore, the scope of application of the reaction method using a stirred reactor is limited, especially not suitable for solid-phase catalyst particles that are inherently fragile

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reaction method
  • Reaction method
  • Reaction method

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0055] Example 1. Monolithic open-pore D-amino acid oxidase immobilized enzyme is directly used as a stirring blade for batch stirring reaction to prepare glutaryl-7-aminocephalosporanic acid (GL-7-ACA)

[0056] First, prepare the honeycomb-shaped immobilized D-amino acid oxidase block according to the following method.

[0057] D-amino acid oxidase converts cephalosporin C into glutaryl-7-aminocephalosporanic acid (GL-7-ACA). Prepare BL-HS-GHA [E.coli BL21(DE3)pLysS containing recombinant D-amino acid oxidase GHA] E. coli cells according to the following method.

[0058] The source of BL-HS-GHA:

[0059] According to the known Thermoanaerobacterium saccharolyticum glucoseisomerase DNA sequence (GenBank L09699), PCR primers were designed, specifically:

[0060] Upstream primer GI-NdeI:

[0061] 5’-AGCCTAGGTTAATTAACTTTAAGAAGGAGATATACATATGAATAAATATTTTGAGA

[0062] Downstream primer GI-EcoRI:

[0063] 5’-ATAAGCTCAGCGGCGCGCCTTATTCTGCAAACAAATAC

[0064] Using Thermoanaerobacterium saccharolytic...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a reaction method applying to catalyze solid phase catalyst, said method uses the reactor including at least one reaction tank, said reaction tank includes tank body and rotating rotate axle fixed in the tank body, said solid phase catalyst is fixed on said rotate axle, said solid phase catalyst has holes which can penetrate reaction liquid and gas, the phase catalyst alsocan be uses as a stirrer when rotates with the rotate axle, it rotates with the rotate axle to generating anticentripetal force in reaction fluid while generates negative pressure in solid phase catalyst, the anticentripetal force enforces the reacting fluid pass the solid phase catalyst along the anticentripetal direction and is kicked off, then the kicked off reaction fluid passes the solid phase catalyst again along negative pressure flow, so it produces circulating reflux to make said reaction fluid and gas pass said solid phase catalyst and make them contact fully and effectively. The reaction method provided in the invention can prevent the vitality of catalyst decline, prolong the life time of catalyst and has characteristics of high exchange efficiency, adequate reaction and wide application range.

Description

Technical field [0001] The invention relates to a reaction method, in particular to a reaction method in which the reaction medium is a liquid. Background technique [0002] In the fields of pharmaceutical industry, food industry, environmental protection, agriculture, light textile industry, chemical industry, etc., reaction methods for various reactions are often realized by means of reactors, and most of the various reactions mentioned require catalysts for reaction. For the reaction in a liquid medium, in order to improve the reaction efficiency, the reactant and the catalyst must be in effective contact. This is especially true when the catalyst is solid. [0003] In the fields of biology, pharmaceutical industry, food industry, environmental protection, agriculture, etc., enzymes or enzyme-containing cells are a more eye-catching type of catalyst among many catalysts. Moreover, currently enzymes or enzyme-containing cells are mostly used in immobilized form. This is because...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): B01J8/10
Inventor王骏金彩科
OwnerBIORIGHT WORLDWIDE