Reactor

A technology of a reactor and a reaction tank, applied in the field of reactors, can solve the problems of large pressure drop in the bed, difficult to feed and vent gas, shortened service life, etc., to achieve the improvement of the reaction speed, the shortened reaction time, and the avoidance of the decline of vitality. Effect

Active Publication Date: 2012-02-29
BIORIGHT WORLDWIDE
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] As far as the packed bed reactor is concerned, the existing problems are: [1] the exchange efficiency between the substrate and the solid phase catalyst is low; [2] the reaction process is not easy to feed and gas, and it is not easy to adjust the pH value and temperature etc.; [3] Not suitable for viscous or insoluble substrates; [4] When using a solid phase catalyst with small particles, the bed pressure drop is large, which leads to easy clogging
[0007] As far as the stirred reactor is concerned, although it can adjust various reaction conditions according to needs, during the stirring process of the stirrer, since the solid phase catalyst is suspended in the substrate solution in the reaction tank, the solid phase catalyst Strong collisions will take place between the particles, between the solid-phase catalyst particles and the agitator, and between the solid-phase catalyst particles and the reaction tank wall (enzymology, edited by Chen Shigen and Zhou Runqi, Fudan University Press, Shanghai, 2001; Biological Reaction Engineering, edited by Qi Yizheng and Xia Jie, Chemical Industry Press, Beijing, 2004), which leads to the fragmentation and wear of solid-phase catalyst particles due to collisions, thereby reducing the activity of the solid-phase catalyst and shortening the service life. And the solid phase catalyst will produce fragments or slag due to fragmentation and wear, and these fragments or slag will be lost with the progress of the reaction, which will hinder the subsequent treatment of the reaction liquid, such as filtration and purification of the product, etc.
Moreover, it is well known that the greater the density and the faster the movement (rotational speed) of the solid-phase catalyst particles suspended in the solution, the higher the efficiency of the reaction; The more easily the catalyst fragments, the faster its activity declines
Therefore, the scope of application of the stirred reactor is limited, especially not suitable for solid-phase catalyst particles that are inherently fragile

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reactor
  • Reactor
  • Reactor

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0051] Example 1. The monolithic open-pore D-amino acid oxidase immobilized enzyme is directly used as a stirring paddle for batch stirring reaction to prepare glutaryl-7-aminocephalosporanic acid (GL-7-ACA)

[0052] First, a honeycomb immobilized D-amino acid oxidase block was prepared as follows.

[0053] D-amino acid oxidase converts cephalosporin C to glutaryl-7-aminocephalosporanic acid (GL-7-ACA). BL-HS-GHA [E. coli BL21(DE3)pLysS containing recombinant D-amino acid oxidase GHA] Escherichia coli cells were prepared in the following manner.

[0054] Source of BL-HS-GHA:

[0055] According to the known DNA sequence of Thermoanaerobacterium saccharolyticum glucoseisomerase (GenBank L09699), PCR primers were designed, specifically:

[0056] Upstream primer GI-NdeI:

[0057] 5’-AGCCTAGGTTAATTAACTTTAAGAAGGAGATATACATATGAATAAATATTTTGAGA

[0058] Downstream primer GI-EcoRI:

[0059] 5’-ATAAGCTCAGCGGCGCGCCTTATTCTGCAAACAAATAC

[0060]Using Thermoanaerobacterium saccharolyticu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a reaction which includes at least one reaction tank, said reaction tank includes tank body and rotating rotation axle installed in tank body, said rotation axle is fixed with solid phase catalyst, said solid phase catalyst has holes which can penetrate reaction liquid and gas, the solid phase catalyst also can be uses as a stirrer when rotates with the rotate axle. The reactor provided in the invention can prevent the vitality of catalyst decline, prolong the life tine of catalyst and has characteristics of high exchange efficiency, adequate reaction and wide application range.

Description

technical field [0001] The invention relates to a reactor, in particular to a reactor which uses a solid-phase catalyst to promote the reaction. Background technique [0002] In the fields of pharmaceutical industry, food industry, environmental protection, agriculture, light textile industry, chemical industry, etc., various reactions are often carried out by means of reactors, and most of the various reactions mentioned above require catalysts for the reaction. For reactions carried out in liquid media, in order to improve the reaction efficiency, the reactants and catalyst must be in effective contact. This is especially true when the catalyst is a solid. [0003] In the fields of biology, pharmaceutical industry, food industry, environmental protection, agriculture, etc., enzymes or enzyme-containing cells are a more attractive type of catalyst among many catalysts. Moreover, at present, enzymes or enzyme-containing cells are mostly used in immobilized forms, because i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): B01J8/10
Inventor王骏金彩科
OwnerBIORIGHT WORLDWIDE