Gene clone method

A cloning method and gene technology, applied in the field of genetic engineering, can solve problems such as complex operations, high substrate concentration, and low connection efficiency, and achieve the effects of high recombination efficiency, simple operation, and high conversion rate

Inactive Publication Date: 2007-08-08
上海德聚生物技术有限公司
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] For sticky ends, if the vector and the insert have the same sticky ends, it is easy to use DNA ligase to ligate into a circular recombinant DNA molecule, but this requires the same sticky ends. Gene fragments and vectors are digested with the same enzyme or processed to make them have the same sticky ends; the advantage of blunt end ligation is that any DNA blunt ends can be connected with T4 ligase, which is very beneficial for the connection of different DNA molecules, but it Ligation efficiency is lower than that of cohesive ends, so more T4 DNA ligase and higher substrate concentration are required; artificial linker or adapter ligation requires more complicated operations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Embodiment 1, the cloning of gene TRF2 (SEQ ID NO:2)

[0014] In this example, double digestion with BamH I and EcoR I was used.

[0015] 1.1. Preparation of vector fragments

[0016] Take 1 μg of pcDNA3.1 / myc-His(-)A vector (purchased from Invitrogen Company), at 37°C, double-digest with enzymes BamHI and EcoR I for 20 hours; 1% agarose gel electrophoresis, detect and recover the length of The pcDNA3.1 / myc-His(-)A vector fragment is about 5500bp.

[0017] 1.2. TRF2 gene amplification

[0018] TRF2 gene was amplified by PCR using human helacDNA library (purchased from Clotech) as template and AM_f and AM_r as primers. The AM_f and AM_r sequences are as follows:

[0019] AM_f: 5'- GTGCTGGATATCTGCAGAATTC CAATGGCGGGAGGAGGCGGGAGTAGCG-3';

[0020] AM_r: 5'- CTTGGTACCGAGCTCGGATC CGTTCATGCCAAGTCTTTTCATGGTCCGCC-3';

[0021] Among them, the 22 underlined DNA sequences in AM_f and the 21 underlined DNA sequences in AM_r are completely identical to the terminal sequences ...

Embodiment 2

[0037] Example 2, Gene IGF1 (SEQ ID NO: 3) Cloning

[0038] In this example, BamH I single-enzyme digestion was used.

[0039] 2.1. Preparation of vector fragments

[0040] Take 1 μg of the pCDNA3.1(-) vector (purchased from Invitrogen), digest it with BamH I for 20 hours at 37°C, and perform 1% agarose gel electrophoresis to detect and recover the pCDNA3.1(-) vector fragment with a length of about 5500 bp .

[0041] 2.2. IGF1 gene amplification

[0042] IGF1 gene was amplified by PCR using human hela cDNA library as template and 0621f and 0621r as primers. The sequences of 0621f and 0621r primers are as follows:

[0043] 0621f: 5'- CCACACTGGACTAGTG GATCCGCAATGGGAAAAATCAGCAGTCTTCCAA-3';

[0044] 0621r: 5'- CTTGGTACCGAGCTCG GATCCCTACTTGTCGTCATCGTCTTTGTAGTCCATCCTGTAGTTCTTGTTTCCTGCACTCCC-3';

[0045] Among them, the 16 underlined DNA sequences in 0621f and the 16 underlined DNA sequences in 0621r are completely identical to the terminal sequences corresponding to the ve...

Embodiment 3

[0059] Embodiment 3, NTF3 gene (SEQ ID NO: 4) cloning

[0060] In this example, BamH I single-enzyme digestion was used.

[0061] 3.1. Preparation of vector fragments

[0062] Take 1 μg of pCDNA3.1(-) vector, digest with BamH I for 20 hours at 37°C, electrophoresis on 1% agarose gel, detect and recover the pCDNA3.1(-) vector fragment with a length of about 5500bp.

[0063] 3.2, NTF3 gene amplification

[0064] The NTF3 gene was amplified by PCR using the human hela cDNA library as a template and 0627f and 0627r as primers. The sequences of 0627f and 0627r primers are as follows:

[0065] 0627f: 5'- ACACTGGACTAGTG GATCCGTGATGTCCATCTTGTTTTATGTGATATTT-3';

[0066] 0627r: 5'- TGGTACCGAGCTCG GATCCTCAGGCGTAGTCTGGCACATCATAGGGGTATGTTCTTCCGATTTTTCTCGACAAG-3';

[0067] Among them, the 14 underlined sequences in 0627f and the 14 underlined sequences in 0627r are completely identical to the end sequences corresponding to the vector fragments.

[0068] PCR conditions: template 10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene cloning method, which comprises the following steps: connecting linear carrier with the same DNA sequences on the adjacent end of double-chain and object gene piece; forming annular DNA molecule; obtaining conversing bacterium; sieving to produce correct gene clone; fitting for augmentation product for kinds of PCR enzyme.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a gene cloning method. Background technique [0002] The traditional gene ligation and cloning method is usually to connect the linear vector and the target gene fragment through T4 DNA ligase to obtain a circular DNA molecule; then transform the ligated DNA molecule into bacteria, and obtain the correct gene clone through screening. [0003] T4 DNA ligase mainly catalyzes the reaction of forming phosphodiester bonds between adjacent 5'-P ends and 3'-OH ends on two DNA strands. It is mainly used in molecular cloning: 1. The connection has homologous complementary stickiness The DNA fragment at the end; 2. Connect the blunt ends between double-stranded DNA molecules; 3. Add synthetic artificial adapters or adapters to the double-stranded blunt-ended DNA molecules; it can also catalyze the connection between DNA and RNA and between a few RNAs connection, but all requ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/10
Inventor邱文英
Owner上海德聚生物技术有限公司