Supercharge Your Innovation With Domain-Expert AI Agents!

Reagent kit and process for detecting Vibrio vulnificus in circular mediated constant temperature amplification method

A ring-mediated isothermal, Vibrio vulnificus technology, applied in biochemical equipment and methods, microbial determination/inspection, fermentation and other directions, can solve the problems of cumbersome operation, time-consuming, can not meet the disease control and other problems, achieve high sensitivity, specificity strong effect

Inactive Publication Date: 2007-08-22
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In the past, there were mainly three ways to detect Vibrio vulnificus: 1. biochemical identification method, which was time-consuming and complicated to operate, and could not meet the needs of disease prevention and control; 2. enzyme-linked immunosorbent assay (ELISA method), which had high sensitivity and detection Fast and other characteristics, can be used for the detection of a large number of specimens, but the false positive problem that occurs when testing fresh samples also limits the wide application of this method to a certain extent; 3. Polymerase chain reaction (PCR method), the The method is faster and more sensitive than the previous two methods, but requires an expensive PCR machine
There are no reports on kits and methods for detection of Vibrio vulnificus by loop-mediated isothermal amplification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] The following examples further illustrate the invention, but should not be construed as limiting the invention.

[0033] Make the loop-mediated isothermal amplification detection kit for Vibrio vulnificus according to the following formula:

[0034] (1) LAMP reaction solution A:

[0035] 2.5uL 10×Thermopol reaction buffer, 1.0uL 10mM dNTP (mixture of four deoxynucleotides), 1.0uL 20uM upstream internal primer (vul-FIP), 1.0uL 20uM downstream internal primer (vul-BIP), 0.25uL 20uM upstream outer primer (vul-F3), 0.25uL 20uM downstream outer primer (vul-B3), 0.5uL 100mM MgSO 4 , 12.5uL 2M betaine and 4uL ddH 2 O (sterilized double distilled water).

[0036] (2) Bst DNA polymerase B: the concentration is 8 U / uL.

[0037] (3) Developer C: 10% SYBR GREEN I.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to reagent kit and process for detecting Vibrio vulnificus in circular mediate constant temperature amplification method. The reagent kit includes: circular mediate constant temperature amplification reactant liquid A with upstream inner primer tgccactcggctacgataacgtttttgagctgtcacggcagttg, downstream inner primer acgcagacaaaacgctcacagtttttgagcttatcgccttcccaat, upstream outer primer tggttcggttaacggctg and downstream outer primer gccatcaacatagcggctaa; and 1-1.5 M beetaine. The detection process includes the following steps: extracting bacterium DNA, circular mediate constant temperature amplification of Vibrio vulnificus, color developing detection, etc. The present invention has the advantages of high speed, high specificity, high sensitivity and low cost.

Description

technical field [0001] The invention relates to a kit for detecting Vibrio vulnificus by using a loop-mediated isothermal amplification method, and further relates to a method for rapidly detecting Vibrio vulnificus using the kit. Background technique [0002] Vibrio vulnificus is a halophilic Gram-negative pathogen widely distributed in oceans and salt lakes. This bacterium is one of the main pathogens causing food-borne diseases. People are infected with this bacterium by eating raw oysters and other seafood and contacting seawater through the gastrointestinal mucosa or damaged skin, which can cause primary sepsis, lower limb trauma infection, and Blister skin lesions, skin ecchymosis, cellulitis, etc., accompanied by high fever, hypotension, shock, eventually develop into septic shock, multiple organ failure and even death, the fatality rate can be as high as 70%. Important microbial quarantine objects for import and export. Vibrio vulnificus is also an important pathog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12P19/34
Inventor 任春华胡超群王青柏罗鹏
Owner SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More