Reagent kit and process for detecting Vibrio vulnificus in circular mediated constant temperature amplification method

Abstract

The present invention relates to reagent kit and process for detecting Vibrio vulnificus in circular mediate constant temperature amplification method. The reagent kit includes: circular mediate constant temperature amplification reactant liquid A with upstream inner primer tgccactcggctacgataacgtttttgagctgtcacggcagttg, downstream inner primer acgcagacaaaacgctcacagtttttgagcttatcgccttcccaat, upstream outer primer tggttcggttaacggctg and downstream outer primer gccatcaacatagcggctaa; and 1-1.5 M beetaine. The detection process includes the following steps: extracting bacterium DNA, circular mediate constant temperature amplification of Vibrio vulnificus, color developing detection, etc. The present invention has the advantages of high speed, high specificity, high sensitivity and low cost.

Description

technical field [0001] The invention relates to a kit for detecting Vibrio vulnificus by using a loop-mediated isothermal amplification method, and further relates to a method for rapidly detecting Vibrio vulnificus using the kit. Background technique [0002] Vibrio vulnificus is a halophilic Gram-negative pathogen widely distributed in oceans and salt lakes. This bacterium is one of the main pathogens causing food-borne diseases. People are infected with this bacterium by eating raw oysters and other seafood and contacting seawater through the gastrointestinal mucosa or damaged skin, which can cause primary sepsis, lower limb trauma infection, and Blister skin lesions, skin ecchymosis, cellulitis, etc., accompanied by high fever, hypotension, shock, eventually develop into septic shock, multiple organ failure and even death, the fatality rate can be as high as 70%. Important microbial quarantine objects for import and export. Vibrio vulnificus is also an important pathog...

AI Technical Summary

Problems solved by technology

[0003] In the past, there were mainly three ways to detect Vibrio vulnificus: 1. biochemical identification method, which was time-consuming and complicated to operate, and could not meet the needs of disease prevention and control; 2. enzyme-linked immunosorbent assay (ELISA method), which had high sensitivity and detection Fast and other characteristics, can be used for the detection of a large number of specimens, but the false positive problem that occurs when testing fresh samples also limits the wide application of this method to a certain extent; 3. Polymerase chain reaction (PCR method), the The method is faster and more sensitive than the previous two methods, but requires an expensive PCR machine

There are no reports on kits and methods for detection of Vibrio vulnificus by loop-mediated isothermal amplification