Immunomodulation agent with adjuvant having function for treating atherosclerosis

A technology for atherosclerosis and immunomodulators, applied in the fields of expression, separation and purification, immunomodulators, and fusion protein CTB-p277, which can solve the problems of weak immunogenicity of vaccines

Inactive Publication Date: 2007-09-19
CHINA PHARM UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] It has been realized that the therapeutic vaccine for autoimmune diseases would be ideal if it can be immunized from the mucosa, but a difficulty in the research of mucosal polypeptide vaccines is that the vaccine immunogenicity of the mucosal route is often weak, so the mucosal therapeutic vaccine is successful. The key is how to improve the mucosal immunogenicity of the vaccine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Immunomodulation agent with adjuvant having function for treating atherosclerosis
  • Immunomodulation agent with adjuvant having function for treating atherosclerosis
  • Immunomodulation agent with adjuvant having function for treating atherosclerosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Embodiment 1: Design, synthesis and cloning of CTB-p277 polypeptide gene

[0066] 1. Acquisition of CTB gene

[0067] On the premise of not changing the CTB gene, using the pET28a-CTB plasmid as a template, the upstream primer P1 and the downstream primer P2 were designed with computer aids. Synthesized by Shanghai Boya Biotechnology Co., Ltd. The pET28a-CTB plasmid was donated by the Department of Microbiology, China Pharmaceutical University.

[0068] Upstream primer P1: 5'GGG TCATGA CACCTCAAAAATATTACTG 3'

[0069] PagI

[0070] Downstream primer P2: 5'AAA GCTAGC ATTTGCCATACTAATTGCGGCAATCGC 3'

[0071] NheI

[0072] A PagI restriction site was introduced into the upstream primer P1, and a NheI restriction site was introduced into the downstream primer P2.

[0073] The pET28a-CTB plasmid was used as a template, and P1 and P2 were respectively used as upstream and downstream primers for PCR amplification.

[0074] The PCR re...

Embodiment 2

[0078] Embodiment 2: Expression of CTB-p277 gene in Escherichia coli

[0079] The recombinant plasmid pET28a-CTB-p277 was transformed into Escherichia coli BL21. Pick single bacterium colony and inoculate containing 50ug / ml kanamycin LB liquid culture medium from growing different transformant plates, cultivate overnight at 37 DEG C of constant temperature shaking, transfer and inoculate into fresh corn steep liquor liquid culture medium by 1% ratio ( 50ug / ml kanamycin), after culturing at 37°C for 4 hours, adding α-lactose at a final concentration of 0.5mmol / L to induce the expression of T7 RNA polymerase in Escherichia coli, and continuing to culture to express the fusion protein CTB-p277. A small amount of bacterial liquid was taken 6 hours after induction, and the bacterial cells were recovered by centrifugation. SDS-PAGE electrophoresis and thin-layer scanning showed that the fusion expression of CTB-p277 polypeptide gene had been realized. The fusion protein accounts fo...

Embodiment 3

[0080] Example 3: Separation and purification of recombinant protein CTB-p277

[0081] The engineered bacteria after induced expression were recovered by centrifugation, suspended in 50ml of 50mmol / L Tris-HCl buffer per 10g of wet bacteria, added 80μl lysozyme (10mg / ml) to each gram of wet bacteria, and then added Triton X- 100 to a final concentration of 0.5%, and shake overnight at 37°C. Add 0.5 μl DNase I (1 mg / ml) to each gram of wet bacteria, and continue shaking at 37°C for 45 minutes. Centrifuge at 10000r / min for 15min, the target protein forms inclusion bodies and appears in the precipitate, discard the supernatant.

[0082] According to the wet weight of each gram of inclusion body, add 10ml of washing solution I to resuspend the precipitate evenly, discard the supernatant after centrifugation, add washing solution II to the precipitate and wash in the same way, and finally wash off the residual washing solution II with distilled water, and precipitate For standby, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an immune modulator for treating arteriosclerosis. Aiming at antigen peptides's weak immunogenicity, a series of epitopes peptides of antigens (SEQ ID NO.1) originating from heat shock protein (HSP60) are inserted into the downstream of Cholera toxin B subunit(CTB), and fusion expression of antigens epitopes peptides and CTB is realized. Produced fusion protein (CTB-p277) and Heat shock protein 65 (HSP65) are coupled chemically, without adjuvant, and directly used immunization. The coupled protein can stimulate body to produce high titer antibody aiming at P277 through mucosal immunity pathway, obviously inhibit occurrence of New Zealand white rabbits's arteriosclerosis, and can have a function for treating arteriosclerosis.

Description

technical field [0001] The invention relates to DNA recombination technology, protein separation and purification technology and medical related fields. More specifically, the present invention relates to the construction, expression, separation and purification of fusion protein CTB-p277, and the chemical coupling of fusion protein CTB-p277 and HSP65. In the medical field, the present invention is an immunomodulator, which can be used to prevent and treat human atherosclerosis. Background technique [0002] Cardiovascular and cerebrovascular diseases caused by atherosclerosis (AS) are one of the diseases that seriously endanger human life and health, and its morbidity and mortality are in the forefront of various diseases. The pathogenic basis of diseases, such as high blood pressure and chronic renal failure, etc., developed countries such as Europe and the United States have listed cardiovascular disease as one of the main killers that endanger human health. In my count...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/39A61K38/17A61P9/10A61P37/02C12N15/62
Inventor刘景晶李建平熊祺焱陈庆梅吴洁曹荣月
OwnerCHINA PHARM UNIV