Protein allergens derivative

A technology of allergens and derivatives, applied in the fields of peptide/protein components, allergic diseases, plant peptides, etc., can solve the problem of IgE binding ability reduction and achieve the effect of scaling up

Inactive Publication Date: 2007-11-07
BIOMAY AG
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Fragmentation of proteins containing predominantly discontinuous / conformational IgE epitopes results in a marked reduction in the IgE binding capacity of the antigen

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein allergens derivative
  • Protein allergens derivative
  • Protein allergens derivative

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0293] Example 1: Characterization of Hypoallergenic Derivatives from Timothy Grass Pollen Arrestin

[0294] a) Generation, expression and purification of Phl p 12, a hypoallergenic variant of Timothy grass pollen suppressor protein

[0295] Genetic engineering of recombinant Phl p 12-derivatives using overlap PCR technique. The PCR template was the cDNA encoding the Timothy grass pollen suppressor protein, Phl p 12, subcloned in the pet17b expression vector. The following primers were used to generate two PCR fragments for protein purification containing overlapping sequences as well as NdeI and EcoRI restriction sites and sequences encoding the carboxy-terminal 6x Histidin residues. For fragment 1, primer MDE-1: 5'CATATGAGGCCCGGCGCGGTCATC3' and primer MDE-2: 5'GTACGTCTGCCACGCCATCATGCCTTGTTCAAC3' were used, and for fragment 2, primer MABC-1: 5'GTTGAACAAGGCATGATGTCGTGGCAGACG3' and primer MABC-2: 5'GAATTCTTAATGGTGATGGTGATGGTGACCCTGTAG were used. In the next step, both PCR pro...

Embodiment 2

[0305] Example 2: Reduction of IgE binding ability of MP12

[0306] a) MP12 exhibits significantly reduced IgE binding capacity

[0307] The IgE binding ability of recombinant MP12 was compared with recombinant Phl p 12 wild type by dot analysis using sera from 24 arrestin-sensitized patients ( FIG. 4 ). Phl p 12 and MP12 and human serum albumin (HSA) for control were spotted onto nitrocellulose and probed with sera from 24 arrestin-sensitized patients. use 125 I-labeled anti-human-IgE antibody detects bound IgE antibody. All patients showed IgE reactivity with PhI p 12 wild type, while none of the 24 patients reacted with MP12 or with the control protein HSA (Figure 4).

[0308] To quantify the reduction in the IgE binding capacity of MP12, fluid phase inhibition was performed. For this, sera from 6 arrestin-sensitized patients were preincubated with 10 μg of Phl p 12 or with MP12 and subsequently incubated with ELISA plate-bound Phl p 12 (5 μg / ml). Bound IgE antibodies ...

Embodiment 3

[0315] Example 3: Immunization with MP12 induces IgG antibodies that recognize Phl p 12 wild type as well as arrestins from other pollens.

[0316] To test whether immunization with the shuffled Phl p 12 induces IgG antibodies reactive with Phl p 12 wild-type and arrestin from other pollen, Freund's complete and incomplete adjuvant (200 μg / injection) (Charles River, Kisslegg, Germany), rabbits were immunized three times with Phl p 12 or MP12. Serum samples were obtained at four week intervals. Serum was stored at -20°C until analysis.

[0317]The reactivity of IgG antibodies induced by MP12 and Phl p 12 was analyzed by ELISA (Fig. 6). Phl p 12 and arrestins from birch (Bet v 2) and mugwort were spread on ELISA plates (5 μg / ml) and incubated with serial dilutions (1:2000-1:64000) of rabbit antisera . Bound rabbit antibodies were detected with peroxidase-labeled donkey anti-rabbit antiserum (AmershamPharmacia Biotech) diluted 1:1000.

[0318] MP12 induced an IgG anti-Phl p ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to View More

Abstract

The present invention relates to a method for producing derivatives of wild-type protein allergens with reduced allergenic activity, characterized in by the following steps: providing a wild-type protein allergen with an allergenic activity, splicing said wild-type protein allergen into two parts, said two parts having a reduced allergenic activity or lacking allergenic activity and rejoining said two fragments in inverse orientation; as well as allergen derivatives.

Description

technical field [0001] The present invention relates to methods of reducing the allergenic activity of wild-type protein allergens, novel allergen derivatives and anaphylaxis vaccination regimens. Background technique [0002] Allergic reactions are genetic or acquired specific variations in the ability to respond to normally harmless foreign (ie, non-proprietary) substances ("allergens"). Allergic reactions and inflammatory reactions in affected organ systems (skin, conjunctiva, nose, pharynx, bronchial mucosa, gastrointestinal tract), symptoms of acute disease (eg, allergic rhinitis, conjunctivitis, dermatitis, anaphylactic shock, and asthma) and Chronic disease manifestations such as asthma and late reactions in atopic dermatitis. [0003] Type I anaphylaxis represents a genetically determined hypersensitivity that afflicts approximately 20% of the population of the industrialized world. The pathophysiological hallmark of type I hypersensitivity reactions is the product...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/415A61K38/16
CPCC07K14/415C12N15/62A61P37/08
InventorK·韦斯特恩M·弗克P·瓦朗W·凯勒R·瓦伦察
OwnerBIOMAY AG