Gene for regulating sensibility of plants to auxin and uses thereof

A technique of auxin, sensitivity, applied in the field of plant genetic engineering

Inactive Publication Date: 2008-05-07
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, the function of the PLDzeta2 gene is still poorly understood in this field, so it is necessary to further study the function of the PLDzeta2 gene in order to apply it to the cultivation of plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for regulating sensibility of plants to auxin and uses thereof
  • Gene for regulating sensibility of plants to auxin and uses thereof
  • Gene for regulating sensibility of plants to auxin and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0074] As an embodiment of the present invention, the gene encoding the PLDzeta2 protein is cloned into an appropriate vector (such as the binary vector p35S-1301) by conventional methods, and the recombinant vector with the foreign gene is introduced into the In plant cells, tissues or organs expressing the PLDzeta2 protein, and then obtain plants overexpressing the PLDzeta2 gene.

[0075] Preferably, the method for preparing the high plant of auxin sensitivity comprises: (1) the coding gene of exogenous PLDzeta2 albumen is transferred into plant cell, tissue or organ, obtains the plant cell, the tissue that is transformed into the coding gene of PLDzeta2 albumen , organs; and (2) regenerating the plant cells, tissues and organs obtained in step (1) into plant plants.

[0076] As a preferred example, the method comprises the steps of:

[0077] (s1) providing an Agrobacterium carrying an expression vector containing a gene encoding the PLDzeta2 protein;

[0078] (s2) contact...

Embodiment 1

[0101] Example 1 Cloning of the PLDzeta2 gene

[0102] The method of screening phage library (Alfandari, D., and Darribère, T. (1994). A simple PCR method for screening cDNA libraries. PCR Methods Appl. 4, 46-49) using conventional 96-well plate PCR method obtained Full-length cDNA clone of the PLDzeta2 gene. In the following examples or drawings, the PLDzeta2 gene obtained from Arabidopsis thaliana is also referred to as AtPLDzeta2 or AtPLDζ2.

[0103] First, primers were designed at the 3' end of the gene according to the known genome sequence information (i.e. the gene sequence of At3g55940 in GenBank):

[0104] AtPLDζ2-1: 5'-TGATCGTTATTTCCGCTAC-3' (SEQ ID NO: 3);

[0105]AtPLDζ2-2: 5'-AAGGTTCCCTCTTGTCTC-3' (SEQ ID NO: 4).

[0106] The primers were used to screen the Arabidopsis thaliana hypocotyl phage cDNA library (purchased from the Arabidopsis thaliana Biological Research Center, ABRC, or refer to http: / / www.arabidopsis.org / ), and the cDNA containing the full-leng...

Embodiment 2

[0109] Example 2 Isolation and Identification of PLDζ2 T-DNA Insertion Mutant atpldζ2

[0110] In order to study the physiological function of the AtPLDζ2 gene, the present inventors also searched the Arabidopsis T-DNA insertion mutant library of the Salk Institute (http: / / signal.salk.edu / tabout.html). The search results show that the mutant line numbered Salk_119084 is an insertion mutant of AtPLDζ2, and the insertion site is 14bp from the end of the third intron in the corresponding AtPLDζ2 gene (Locus number is At3g55940) to the fourth exon s position.

[0111] The mutants obtained from the Salk mutant library were screened for Kan resistance, and then the T-DNA insertion site was detected for the resistant plants. DNA was extracted from the seedlings of the plant by conventional methods, using primer Lbal (5'TGGTTCACGTAGTGGGCCATCG 3 (SEQ ID NO: 5)') on the T-DNA vector and gene-specific primer P2 (5'-CTCTAGCAAATGAGAGTCTAG-3' (SEQ ID NO: 6)) carried out PCR amplificati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a purpose of phosphatidase Dzeta2 protein on the aspect of adjusting the sensibility of plants to somatotropic hormone or the response aspect to the low phosphorus stress. The invention also discloses a preparation method for the plants which have high sensibility to the somatotropic hormone or high responsibility to the low phosphorus stress. The invention leads the phosphatidase Dzeta2 protein, and the somatotropic hormone sensibility and the low phosphorus stress responsibility of the plants to be related, genetically modified plants which have high sensibility to the somatotropic hormone or high responsibility to the low phosphorus stress can be prepared, thereby the application amount of field somatotropic hormone can be greatly decreased, the absorption of the plants to low phosphorus is increased, and the agricultural cost can be greatly reduced.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering and relates to the application of a phospholipid hydrolase in plants, in particular to the application of PLDzeta2 in regulating the response of plants to plant hormone auxin and the response of plants to low phosphorus stress. Background technique [0002] Phospholipids are a class of lipids composed of phosphoric acid that widely exist in the body, mainly including glycerophospholipids and sphingomyelins. The phospholipids commonly referred to mainly refer to glycerophospholipids, which have many types and fast turnover in the body. They are both hydrophilic and hydrophobic. A class of facultative molecules that are not only the basic components of cell membranes, but also can be used as signal substances to respond to external environmental stimuli. Common phospholipid molecules in plants include phosphatidylinositol, phosphatidylethanolamine, phosphatidylserine, phosphatidylcholesterol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/16C12N15/82C12N15/55C12N15/29A01H4/00
Inventor 薛红卫李刚
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap