Ankylosing spondylitis pathopoiesia correlation gene IRS-1 mutant gene, detecting method and reagent kit thereof
A technology related to ankylosing spondylitis and disease-causing genes, applied in anti-inflammatory agents, gene therapy, genetic engineering, etc., can solve problems such as diagnosis of ankylosing spondylitis without laboratory diagnostic reagents
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] AS family members were collected nationwide (8 AS patients, 18 non-patients), 97 sporadic AS patients and 122 healthy controls were screened. All patients were diagnosed by rheumatologists and met the New York criteria revised in 1994. The family map was constructed using Cyrillic 2.0 software. After analyzing the pedigree of the family, the following characteristics can be found: 1) There are patients in three consecutive generations, and they are passed on continuously. 2) There are both female and male patients, and the chances of the disease are equal for both men and women. Therefore, it was found that the two families conformed to the autosomal dominant inheritance pattern.
[0041] See the experimental procedure figure 2 .
[0042] Selection of Microsatellite Loci and Design of Primers
[0043] 1. Selection of microsatellite loci for genome-wide scanning and primer design:
[0044] The microsatellite marker primers in the ABI company PRISMRLinkageMapping S...
Embodiment 2
[0068] Detection of mutation gene of ankylosing spondylitis-related gene IRS-1:
[0069] The kit for diagnosing the IRS-1 mutation gene, an ankylosing spondylitis-related gene, mainly includes:
[0070] PCR primers for amplifying the 2759-site gene fragment containing IRS-1, Taq DNA polymerase and corresponding buffer.
[0071] The PCR primers are as follows:
[0072] Upstream primer: IRS-1-F: CGGATGAGTATGGCTCCAGT
[0073] Downstream primer: IRS-1-R: ACCTCCAATGTCAGGAGAGC.
[0074] 1. Preparation of blood sample DNA of the subject to be tested
[0075] 1. Research objects: clinically all rheumatic patients with inflammatory low back pain, or patients with suspected ankylosing spondylitis.
[0076] 2. Genomic DNA extraction: using the modified Miller method
[0077] a. Take 3-5ml of sodium citrate or EDTANa2 anticoagulated whole blood (try not to use heparin for anticoagulation), and place it in a 50.0ml capped centrifuge tube;
[0078] b. Add 5-8 times the volume (about 4...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com