Method for providing recombinant baculovirus with polyhedrosis coatings
A technology for recombining baculovirus and silkworm baculovirus, which is applied in the application field, can solve problems such as a large number of manpower, affecting the survival rate of silkworm larvae, bacterial infection, etc., and achieve the effect of improving labor efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] (1) Amplify the fragment of the silkworm polyhedron gene: with the DNA of the silkworm baculovirus as a template, with P1: actgaattcaccgcgcggcggtatgtaca and P2: tgcggtaccagatacaaagacgctgaaa as primers, the polyhedron gene fragment is amplified by PCR method, and the sequence is as shown in SEQ No.1 As shown, the promoter is 400bp, the coding region is 738bp, and the 3-terminal regulatory region is 162bp. The reaction conditions are: 94°C for 45 seconds, 55°C for 45 seconds, 72°C for 100 seconds, 30 cycles.
[0017] (2) The DNA fragment amplified by the above method was digested by EcoR I and Kpn I, and connected to the insect transposable plasmid piggyBac digested with the same enzymes to form the plasmid piggyBac-poly of the recombined transposable polyhedron gene. The plasmid can refer to literature (Wu Xuefeng, Xu Hanfu, Liu Chun, Xia Qingyou, Expression of Bombyx mori Transgene Vector pBacA3EG in Bombyx mori Cultured Cells, Silkworm Science Communication, 2007, 27(2...
Embodiment 2
[0024] Basically the same as Example 1, the difference is that Bmpak6 and BmNPV-GFP virions are respectively infected with the above-mentioned transformed BmN cells according to (5) in the above-mentioned embodiment, and after 4 days, according to (6) in the above-mentioned embodiment Collect virus polyhedron and the cell culture fluid as contrast, add food silkworm larva again by (7) in the above-mentioned embodiment, calculate the percentage rate of silkworm infection (Bmpak6 virus reference: Wang Wenbing, Yao Bin, Xiao Qingli, Ji Ping, Wang Shengpeng , He Jialu, Wu Xiangfu. Expression of phytase gene in Bombyx mori-baculovirus expression system and its enzymatic properties, Acta Biological Engineering, 2003, 19(1): 112-115; BmNPV-GFP virus reference: Motohashi T , Shimojima T, Fukagawa T, Maenaka K, Park FY. Efficient large-scale protein production of larvae and pupae of silkworm by Bombyxmori nuclear polyhedrosis virus bacmid system. Biochemical and Biophysical Research Com...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 