Supercharge Your Innovation With Domain-Expert AI Agents!

Method for providing recombinant baculovirus with polyhedrosis coatings

A technology for recombining baculovirus and silkworm baculovirus, which is applied in the application field, can solve problems such as a large number of manpower, affecting the survival rate of silkworm larvae, bacterial infection, etc., and achieve the effect of improving labor efficiency

Inactive Publication Date: 2008-06-25
JIANGSU UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are two disadvantages in this method. One is that each injection requires a lot of manpower, and the other is that after the body wall of the silkworm larvae is destroyed by the needle, it is easy to cause bacterial infection and affect the survival rate of the silkworm larvae.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for providing recombinant baculovirus with polyhedrosis coatings
  • Method for providing recombinant baculovirus with polyhedrosis coatings

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] (1) Amplify the fragment of the silkworm polyhedron gene: with the DNA of the silkworm baculovirus as a template, with P1: actgaattcaccgcgcggcggtatgtaca and P2: tgcggtaccagatacaaagacgctgaaa as primers, the polyhedron gene fragment is amplified by PCR method, and the sequence is as shown in SEQ No.1 As shown, the promoter is 400bp, the coding region is 738bp, and the 3-terminal regulatory region is 162bp. The reaction conditions are: 94°C for 45 seconds, 55°C for 45 seconds, 72°C for 100 seconds, 30 cycles.

[0017] (2) The DNA fragment amplified by the above method was digested by EcoR I and Kpn I, and connected to the insect transposable plasmid piggyBac digested with the same enzymes to form the plasmid piggyBac-poly of the recombined transposable polyhedron gene. The plasmid can refer to literature (Wu Xuefeng, Xu Hanfu, Liu Chun, Xia Qingyou, Expression of Bombyx mori Transgene Vector pBacA3EG in Bombyx mori Cultured Cells, Silkworm Science Communication, 2007, 27(2...

Embodiment 2

[0024] Basically the same as Example 1, the difference is that Bmpak6 and BmNPV-GFP virions are respectively infected with the above-mentioned transformed BmN cells according to (5) in the above-mentioned embodiment, and after 4 days, according to (6) in the above-mentioned embodiment Collect virus polyhedron and the cell culture fluid as contrast, add food silkworm larva again by (7) in the above-mentioned embodiment, calculate the percentage rate of silkworm infection (Bmpak6 virus reference: Wang Wenbing, Yao Bin, Xiao Qingli, Ji Ping, Wang Shengpeng , He Jialu, Wu Xiangfu. Expression of phytase gene in Bombyx mori-baculovirus expression system and its enzymatic properties, Acta Biological Engineering, 2003, 19(1): 112-115; BmNPV-GFP virus reference: Motohashi T , Shimojima T, Fukagawa T, Maenaka K, Park FY. Efficient large-scale protein production of larvae and pupae of silkworm by Bombyxmori nuclear polyhedrosis virus bacmid system. Biochemical and Biophysical Research Com...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for obtaining polyhedron by recombining baculovirus and utilizing the obtained polyhedron to feed, wherein, silkworm baculovirus polyhedron genes are transposed onto chromosomes of silkworm cells; recombined silkworm baculoviruses are infected the silkworm cells after modification; the polyhedron genes positioned on the chromosomes of the silkworm cells express along with stimulus of expression of virogenes, thereby the recombined baculoviruses can be embedded into the polyhedron; the polyhedron is then sprayed on mulberry leaves, and silkworm larvae can be infected after eating the mulberry leaves, thereby work efficiency is greatly improved.

Description

technical field [0001] The invention belongs to the field of bioengineering, and relates to the packaging of recombinant baculovirus and the use of feeding insect larvae, etc., in particular to the application in the expression of exogenous genes by silkworm baculovirus. Background technique [0002] Baculoviruses are double-stranded DNA viruses that mainly use Lepidoptera insects as hosts. More than 600 strains of baculoviruses have been recorded so far. The naming of the virus is mainly based on the host of the isolated baculovirus, such as Bombyx mori baculovirus (BmNPV), tussah baculovirus, tea geometrid baculovirus, gypsy moth baculovirus, American white moth baculovirus, etc. The structural feature of baculovirus is that the virus particle is rod-shaped, covered with a layer of protein membrane, and has certain rules in appearance, which is called polyhedrin. The infection process of baculovirus is realized in this way: the virus polyhedron is scattered in the enviro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/09C12N15/34C12N15/866C12N7/01
Inventor 王文兵乌慧玲吴言陈璐
Owner JIANGSU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More