Rice bZIP and application of the same in improving stress tolerance of plants
A plant and genetic technology, applied in the fields of application, plant peptides, genetic engineering, etc., to achieve the effect of broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1, acquisition of stress tolerance gene
[0037] Isolation of OsbZIP52, OsbZIP71 and OsbZIP73 genes
[0038] Search the TIGR database, Huada BGI database, and other comprehensive databases such as NCBI to obtain the predicted coding sequences of the three genes, and design 5' primers starting from the coding start site ATG of the three genes, and stop at the codon Design 3' end primers:
[0039] 5' end primer
[0040] OsbZIP52: CACCACAAAAATGGGTCGGAGGAAGGCGATGATG
[0041] OsbZIP71: CACCACAAAATGTCGAGTGGGACCTCGTCCGGG
[0042] OsbZIP73: CACCACAAAATGCTGCACCACCATTACCATGGC
[0043] 3' end primer
[0044] OsbZIP52: AGGCCACACATCAGCCGAGCAGCT
[0045] OsbZIP71:GAAGCACTGGTACTGGTACAAGTC
[0046]OsbZIP73: AATATTCTCGCATGGCTGTGAGGA
[0047] The total RNA of Guangluai 4 rice at the grain filling stage was extracted, cDNA was obtained by reverse transcription, and the full-length gene was obtained by RT-PCR amplification with three pairs of primers respectively. The ge...
Embodiment 2
[0049] Example 2. Obtainment of transgenic rice of OsbZIP52 / OsbZIP71 / OsbZIP73 related to stress tolerance in rice
[0050] The gene OsbZIP52 / OsbZIP71 / OsbZIP73 related to stress tolerance obtained in Example 1 was transformed into rice by Agrobacterium-mediated method, and the specific method was as follows:
[0051] 1) Transform Agrobacterium
[0052] The OsbZIP52 / OsbZIP71 / OsbZIP73 gene in the recombinant plasmid pENTER-TOPO Vector-OsbZIP52 / OsbZIP71 / OsbZIP73 constructed in Example 1 was recombined into the expression vector pH2GW7 by LR reaction. The LR reaction system was 2 μl buffer, 2 μl (150-300 ng ) Linearized pH2GW7 plasmid DNA, 2 μl (100-300 ng) pENTER-TOPO Vector-OsbZIP52 / OsbZIP71 / OsbZIP73 plasmid DNA, 2 μl H 2 O, then add 2 μl LR Clonase, the LR reaction conditions are 25 °C water bath for 1 h, add 1 μl 2U / μl proteinase K, and 37 °C water bath for 10 min. Then, the above recombinant vector was transformed into Escherichia coli (E.coli) DH5α competent cells by heat s...
Embodiment 3
[0057] Example 3. Transgenic T 1 Drought tolerance identification of progeny plants
[0058]Harvest OsbZIP73 / OsbZIP71 / OsbZIP52 T 1 Generation of transgenic rice seeds. The seeds were soaked in water and cultured for 3 days to germinate, and then 50mg / L hygromycin was used for resistance screening. At the same time, the non-transgenic rice Zhonghua 11 was used as a control. After 5 days of screening, all the control plants died, and the resistant seedlings and dead seedlings of the transgenic plants were counted. The results showed that OsbZIP73 / OsbZIP71 / OsbZIP52 T with single-site insertion was obtained by analyzing the resistance segregation ratio of transgenic plants. 1 The transgenic lines were further cultivated for one week and then subjected to drought treatment, while the non-transgenic rice Zhonghua 11 was set as a control. The rice seedlings are planted in the soil of the box, using vermiculite: the mixed soil of the nutrient soil mixing ratio is 3: 1, and the wate...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 