Unlock instant, AI-driven research and patent intelligence for your innovation.

Rice bZIP and application of the same in improving stress tolerance of plants

A plant and genetic technology, applied in the fields of application, plant peptides, genetic engineering, etc., to achieve the effect of broad application prospects

Active Publication Date: 2011-07-20
BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are few studies on the functions of bZIP family members that have been isolated in rice. Most of the existing data only speculate that these genes may be involved in certain growth and development processes (such as regulation of seed development) or in response to external stimuli without direct experimental evidence for an associated function

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice bZIP and application of the same in improving stress tolerance of plants
  • Rice bZIP and application of the same in improving stress tolerance of plants
  • Rice bZIP and application of the same in improving stress tolerance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1, acquisition of stress tolerance gene

[0037] Isolation of OsbZIP52, OsbZIP71 and OsbZIP73 genes

[0038] Search the TIGR database, Huada BGI database, and other comprehensive databases such as NCBI to obtain the predicted coding sequences of the three genes, and design 5' primers starting from the coding start site ATG of the three genes, and stop at the codon Design 3' end primers:

[0039] 5' end primer

[0040] OsbZIP52: CACCACAAAAATGGGTCGGAGGAAGGCGATGATG

[0041] OsbZIP71: CACCACAAAATGTCGAGTGGGACCTCGTCCGGG

[0042] OsbZIP73: CACCACAAAATGCTGCACCACCATTACCATGGC

[0043] 3' end primer

[0044] OsbZIP52: AGGCCACACATCAGCCGAGCAGCT

[0045] OsbZIP71:GAAGCACTGGTACTGGTACAAGTC

[0046]OsbZIP73: AATATTCTCGCATGGCTGTGAGGA

[0047] The total RNA of Guangluai 4 rice at the grain filling stage was extracted, cDNA was obtained by reverse transcription, and the full-length gene was obtained by RT-PCR amplification with three pairs of primers respectively. The ge...

Embodiment 2

[0049] Example 2. Obtainment of transgenic rice of OsbZIP52 / OsbZIP71 / OsbZIP73 related to stress tolerance in rice

[0050] The gene OsbZIP52 / OsbZIP71 / OsbZIP73 related to stress tolerance obtained in Example 1 was transformed into rice by Agrobacterium-mediated method, and the specific method was as follows:

[0051] 1) Transform Agrobacterium

[0052] The OsbZIP52 / OsbZIP71 / OsbZIP73 gene in the recombinant plasmid pENTER-TOPO Vector-OsbZIP52 / OsbZIP71 / OsbZIP73 constructed in Example 1 was recombined into the expression vector pH2GW7 by LR reaction. The LR reaction system was 2 μl buffer, 2 μl (150-300 ng ) Linearized pH2GW7 plasmid DNA, 2 μl (100-300 ng) pENTER-TOPO Vector-OsbZIP52 / OsbZIP71 / OsbZIP73 plasmid DNA, 2 μl H 2 O, then add 2 μl LR Clonase, the LR reaction conditions are 25 °C water bath for 1 h, add 1 μl 2U / μl proteinase K, and 37 °C water bath for 10 min. Then, the above recombinant vector was transformed into Escherichia coli (E.coli) DH5α competent cells by heat s...

Embodiment 3

[0057] Example 3. Transgenic T 1 Drought tolerance identification of progeny plants

[0058]Harvest OsbZIP73 / OsbZIP71 / OsbZIP52 T 1 Generation of transgenic rice seeds. The seeds were soaked in water and cultured for 3 days to germinate, and then 50mg / L hygromycin was used for resistance screening. At the same time, the non-transgenic rice Zhonghua 11 was used as a control. After 5 days of screening, all the control plants died, and the resistant seedlings and dead seedlings of the transgenic plants were counted. The results showed that OsbZIP73 / OsbZIP71 / OsbZIP52 T with single-site insertion was obtained by analyzing the resistance segregation ratio of transgenic plants. 1 The transgenic lines were further cultivated for one week and then subjected to drought treatment, while the non-transgenic rice Zhonghua 11 was set as a control. The rice seedlings are planted in the soil of the box, using vermiculite: the mixed soil of the nutrient soil mixing ratio is 3: 1, and the wate...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a group of bZIP genes which are derived from rice and are related with stress tolerance, the encoded protein has one of the following amino acid sequences: 1) the SEQ ID No: 1, 3 or 5 in a sequence table; 2) the amino acid residue sequence of the SEQ ID No: 1, 3 or 5 in the sequence table is treated with the substitution, deletion or adding of one to ten amino acid residues and the derived protein has the effect of regulating the performance of plant stress tolerance. The experiments proves that the transgenic rice of the invention can improve the tolerance of the rice to high-salt, drought and low-temperature adversity threats and have no apparent impacts on the normal growth and the economic traits of the rice. The protein and the encoded genes of the invention have important theoretical and practical significances on the research of a plant stress tolerance mechanism, the improvement of the plant stress tolerance and the improvement of the related traits, thereby playing an important role in the stress tolerance genetic engineering improvement of plants (more particularly cereal crops) and having broad application prospect.

Description

technical field [0001] The invention relates to a gene related to plant stress tolerance and its application, in particular to a bZIP transcription factor related to stress tolerance derived from rice and the application of its encoding gene in cultivating stress-tolerant plants. Background technique [0002] Transcription factors, as direct regulators of gene expression, play important roles in the developmental and physiological processes of various organisms. Usually, after the organism receives various internal and external stimuli, it first regulates the changes in the expression levels of transcription factors, and finally causes the expression changes of effector target genes, which are then expressed as the body's response. Among the numerous transcription factor families, several family transcription factors coexist in plants and animals, including the bZIP (basic leucine zipper) family. This family of genes is numerous and structurally diverse, but they all contai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82C12N15/65C07K14/415A01H1/00
Inventor 王喜萍
Owner BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED