Supercharge Your Innovation With Domain-Expert AI Agents!

Method for preparing bone morphogenic protein BMP-2 mature peptide

A morphogenetic protein, BMP-2 technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, peptide sources, etc., can solve the problems of immunogenicity, inconsistent amino acid sequence of BMP-2, etc.

Inactive Publication Date: 2008-08-06
ZHEJIANG UNIV OF TECH
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the obtained product is inconsistent with the natural BMP-2 amino acid sequence, and it may cause immunogenicity when used in humans
Although the use of inclusion bodies to prepare the target protein has the advantage of low cost, the inclusion bodies contain certain miscellaneous proteins and nucleic acids, and the target protein accounts for about 80% of the total protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing bone morphogenic protein BMP-2 mature peptide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Example 1: Removal of DsbA signal peptide gene

[0070] Primer design: DsbA-1: 5'AAGCATATGGCGCAGTATGAAGAT 3'24bp

[0071]DsbA-2: 5' TCGCTTAAGTATTTCACTGT 3' 20bp

[0072] PCR template: pET39 plasmid

[0073] PCR parameters: 94°C 3min

[0074] 94℃ 30s 40℃ 30s 72℃ 1min 3 cycles

[0075] 94℃ 30s 48℃ 30s 72℃ 1min 27 cycles

[0076] 72°C 10min

[0077] 4°C 10min

[0078] The PCR product and pET39 plasmid were digested with NdeI and BspTI to replace the original DsbA gene in pET39 with a DNA fragment without signal peptide gene, and the obtained recombinant plasmid was named pET39(SP-).

Embodiment 2

[0079] Example 2: Acquisition of the gene encoding "Linker-6His-Eksite-BMP-2"

[0080] First, design the DNA fragment encoding "Linker-6His-Eksite" according to the preferred codons of Escherichia coli, the sequence is as follows: ATA CTTAAG CGAGAAAAAAGGTTCTGGTTCTGGTCATCATCATCATCATGATGACGATGACAAA, where the underlined part is the BspTI recognition sequence. In order to splice the DNA fragment with the BMP-2 gene smoothly, the following four primers were designed and spliced ​​by SOE technology.

[0081] Primer Linker-1:

[0082] 5'ATA CTTAAG CGAGAAAAAAGGTTCTGGTTCTGGTCATCATCATCATCAT 3'46bp

[0083] Primer Linker-2:

[0084] 5'TTGCTTATGCTTTGCTTGTTTGTCATCGTCATCATGATGATGATGATGATGACC 3'54bp

[0085] Primer BMP2-1:

[0086] 5'GACGATGACAAA CAAGCAAAGCATAAGCAA 3' 30bp

[0087] Primer BMP2-2:

[0088] 5'TTCGGATCCTTAGCGACAGCCACAACCTT 3' 30bp

[0089] Operation method:

[0090] Since primer Linker-1 and primer Linker-2 have 18bp reverse complementarity, take 2uL each of prime...

Embodiment 3

[0098] Embodiment 3: construction of engineering bacteria

[0099] The product C was digested with BspTI and BamHI, and recombined into pET39(SP-) according to conventional molecular biology techniques to obtain the recombinant plasmid pETDsbA-BMP (see figure 1 ), the recombinant plasmid pETDsbA-BMP was transformed into E.coli BL21(DE3), and the engineered bacteria were preserved after sequencing and identification. For expression research and production.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method of recombination bone morphogenetic protein BMP-2 mature peptide, which comprises deleting the 2-18 amino acid encoding genes of DsbA gene signal peptide, keeping the codon of the first methilanin as starting codon to obtain a section recombined in expression carrier to obtain recombination plasmid 1, recombining the DNA of the bone morphogenetic protein BMP-2 complete mature peptide in the descending of the DsbA gene of recombination plasmid 1 to obtain recombination plasmid 2, transferring the recombination plasmid 2 into the thallus of expression host strain to obtain engineering bacteria, via cultivation and adding inducer to express target gene, breaking bacteria, separating and purifying to obtain DsbA-BMP-2 fusion protein, cutting the DsbA-BMP-2 fusion protein via prolease, separating to obtain the one morphogenetic protein BMP-2 mature peptide. The inventive product has same amino acid sequence of natural BMP-2 mature peptide, to realize soluble cell fusion expression, while the fusion protein can be purified further via Ni2+ affinity chromatography to simplify the purification before BMP-2 renaturation.

Description

(1) Technical field [0001] The invention relates to a method for preparing bone morphogenetic protein BMP-2 mature peptide, in particular to a method for obtaining the BMP-2 mature peptide which is completely consistent with the amino acid sequence of the natural BMP-2 mature peptide. (2) Background technology [0002] Bone Morphogenetic Protein-2 (BMP-2) is a member of the transforming growth factor superfamily. BMP can induce undifferentiated mesenchymal cells to differentiate into cartilage and bone, and plays an important role in regulating the formation and development of embryonic skeleton and various organs. The unique osteogenic activity of BMP makes it have broad application prospects in bone injuries and diseases, such as fractures, bone defects and oral and facial surgery. In recent years, through DNA recombination technology, more than ten kinds of recombinant BMP proteins have been widely studied in basic and clinical applications, and the research on the role ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C12N15/09C12N15/12C12N1/21C12P21/02
Inventor 林陈水付水星任慧颖黎小军徐伟于真真许明郑小玲钱俊青
Owner ZHEJIANG UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com