Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Type II streptococcus suis sa1KR gene knockout mutant strain, preparation method and application thereof

A gene knockout and Streptococcus suis technology, applied in the field of bacteria, can solve the problems of multiple antigenic components, local or systemic toxicity, large inoculation dose, etc., and achieve the effect of large sequence similarity

Inactive Publication Date: 2008-10-29
ARMY MEDICAL UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The inactivated vaccine is an inactivated whole-bacteria dead vaccine. Its biggest advantage is that it is easy to prepare and produce, and it is stable and easy to store. The reaction is obvious, and some vaccines have poor protection
The advantage of the live attenuated vaccine is that it only needs to be vaccinated once, the inoculation dose is small, the immune effect is better, and the immunity is long-lasting; the disadvantage is that it is unstable, difficult to store, and virulence may reverse mutation
The above two vaccines are all bacteria-based vaccines, and their common disadvantage is that the antigen components injected into the body are many and complex, and many components are actually non-protective antigens
The existence of these non-protective antigen components interferes with the body's response to protective antigens (sometimes the response to non-protective antigens becomes the main response, while the protective antigen is a non-main response or even no response); The presence of antigens may bring about severe immune side effects, such as fever, immune diseases, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Type II streptococcus suis sa1KR gene knockout mutant strain, preparation method and application thereof
  • Type II streptococcus suis sa1KR gene knockout mutant strain, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1: Construction of gene knockout vector

[0040] (1) Primer design: According to the upstream and downstream DNA sequences of the salKR coding gene in the S. suis2 wild strain 05ZYH33 genome (SEQ ID NO: 4 and 5 in the sequence table), PCR primers were designed. The base sequences are as follows:

[0041] LA1: 5'GT GGATCC TAGCTTATTTTTACTGTTATC 3’

[0042] (The underline is the introduced EcoR I restriction site)

[0043] LA2: 5'AG CTGCAG ATGGAGGAAATGCGGAATC 3'

[0044] (The underline is the introduced BamH I restriction site)

[0045] RA1: 5'AT GGTACC AATTACCCTTTTTACTCAT 3'

[0046] (The underline is the introduced Pst I restriction site)

[0047] RA2: 5'AA GGGCCC CACCGACACTTCCACTACCTA 3’

[0048] (The underline is the introduced Hind III restriction site)

[0049]Primers LA1 and LA2 were used to amplify the upstream DNA fragment of the gene encoding salKR, and primers RA1 and RA2 were used to amplify the downstream DNA fragment. To meet the nee...

Embodiment 2

[0070] Example 2: Screening and Identification of Avirulent Type 2 Streptococcus Suis Mutants

[0071] (1) Electrotransformation: The constructed gene knockout vector pUC::salKR was electrotransformed into S. suis 2 wild strain 05ZYH33 competent cells, and the bacterial solution was spread on a THB plate containing spectinomycin, and cultured at 37°C for 24 -48 hours.

[0072] (2) Screening: Select Streptococcus suis colonies from the spectinomycin THB plate, cultivate them in 2ml liquid THB medium respectively, each get 2 μl of bacterial liquid as a template, and use primers check1 and check2 (located inside the salKR gene, the primer sequence is

[0073] check1: GGGGGACTATTACTTTTTGAG,

[0074] check2: TTTCTTTTTCGCGTTCTGTC

[0075] A preliminary screening by PCR was performed. If the salKR gene is knocked out, PCR amplification will give a negative result, and if a product of the expected size (514bp) can still be amplified, it means that the salKR gene has not been knocke...

Embodiment 3

[0077] Embodiment 3: animal experiments

[0078] In order to detect the pathogenicity of the type 2 Streptococcus suis mutant strain to the host animal, a single colony of S. suis2 wild strain 05ZYH33 and mutant strain 05ZYH33ΔsalKR was picked on the plate, and cultured in THB medium at 37°C with shaking until logarithmic mid-growth (OD 600 ≈0.6), take 0.5ml bacterial solution (about 10 8 CFU dose) centrifuged to collect the thalli, and resuspended the bacterium with an equal volume of sterile PBS buffer. Through the method of ear vein injection, the healthy Landrace piglets (6 pigs / each strain) were challenged with the wild strain and the mutant strain, and the signs of the infected animals were closely observed. Variety. It was found that the experimental pigs injected with the mutant strain had no obvious pathological reaction, while the landrace pigs injected with the same dose showed typical S. suis2 infection symptoms, such as arthritis, endocarditis, respiratory fail...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene knock-out mutant of Streptococcus suis type 2 salKR and the preparation method and the application thereof. The mutant 05ZYH33 delta salKR has the preservation number of CGMCC No.2259. The preparation method comprises a step of subjecting a dual signal transduction system in PAI89K pathogenicity island on chromosome 05ZYH33 of wild S.suis 2 strain to gene knock-out by homologous recombination technology. Verified by PCR identification and Southern blotting, the obtained stain is gene knock-out mutant named as 05ZYH33 delta salKR. Animal test shows that the mutant has no harm to animals, and the whole genome sequence of the mutant has large similarity to that of the wild strain, so that the mutant is suitable for research and production of vaccines.

Description

technical field [0001] The invention belongs to bacteria, and specifically relates to a preparation method of a type 2 Streptococcus suisserotype (Streptococcus suisserotype 2) salKR gene knockout mutant strain and its application in the development of Streptococcus suis disease vaccine. Background technique [0002] Streptococcus suis type 2 (S. suis2 for short) is an important zoonotic pathogen. Pigs are generally susceptible to S. suis 2, and infection can cause acute sepsis, pneumonia, meningitis, arthritis, endocarditis, and acute death. If not treated in time, the fatality rate can reach 40%. Growth is slow, and the storage time is greatly extended. In recent years, the prevalence of S. suis 2 in swine herds in southern provinces of my country has become increasingly serious, and large-scale outbreaks have occurred from time to time, causing economic losses of several billion yuan each year. The pathogen infects humans and can cause serious diseases such as meningiti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/31A61K39/09A61P31/04
Inventor 李明胡福泉唐家琪申晓冬
Owner ARMY MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products