RT-PCR method for testing hantavirus genome
A technology of Hantavirus and genome, applied in the field of detecting Hantavirus genome, achieves the effects of high sensitivity, increased genus specificity, and high positive detection rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Embodiment 1: RT-PCR method detects the genomic RNA of HV positive template
[0029] A. Synthesize two pairs of universal primers for the novel hantavirus, and hand them over to Shanghai Sangong Co., Ltd.:
[0030] a. The upstream primer of HV P1 / P2 is GATTGAAGATATTGAGTCACC,
[0031] The downstream primer is GTTGTATCCCCATTGATTGTG;
[0032] b. The upstream primer of HV P3 / P4 is TGAGAAATGTGTATGACATGA,
[0033] The downstream primer is ACTAGACACTGTTTCAAATGA.
[0034] B. Hantavirus genome detection method:
[0035] 1. Preparation of positive template
[0036] After Vero E6 cells were routinely cultured into a single layer, 100TCID were inoculated 50 1ml each of the HV 76-118 and HV 114 strain viruses, adsorbed for 2 hours, the culture solution was replaced with a maintenance solution containing 2% fetal bovine serum, and the culture was continued at 37°C in a CO2 incubator. After 14 days, a small number of cells were scraped for HV-specific immun...
Embodiment 2
[0047] Embodiment 2: RT-PCR method detects HV RNA in the old serum sample
[0048] RT-PCR detection of 432 HV serum samples from 1985-1989 and 1996-2007. Because the level of viral nucleic acid in serum is low, and RNA is easily degraded, the detection rate of viral RNA in old serum is usually extremely low. In this study, each extracted nucleic acid sample was amplified in parallel by using new HV primers (HV P1 / P2 and HV P3 / P4).
[0049] 1. RNA extraction
[0050] Take 200 μl of serum, and use a total RNA extraction kit (promega company product) to extract serum total RNA according to the kit instructions.
[0051] 2. Determination of the purity and concentration of RNA
[0052] Measure the optical density values OD260 and OD280 of RNA samples at 260nm and 280nm wavelengths respectively, and determine the RNA purity by calculating OD260 / OD280. The results show that all RNA samples OD260 / OD280≥1.9, indicating that the RNA is of high purity and free from DNA and protein c...
Embodiment 3
[0060] Embodiment 3: RT-PCR method is used for epidemiological detection HV RNA in mouse lung tissue
[0061] In 2002, 204 rat tissue specimens were collected from four counties of Jiangxia, Nanzhang, Qichun and Xinzhou in Hubei for RT-PCR testing. In this study, each extracted nucleic acid sample was amplified in parallel by using new HV primers (HV P1 / P2 and HV P3 / P4), and those with specific bands were positive for HV infection.
[0062] 1. RNA extraction
[0063] The rats were sacrificed by cervical dislocation after ether anesthesia, and about 20-30 mg of lung tissue was taken from the rats. After homogenization, total RNA was extracted with a total RNA extraction kit (promega company product) according to the kit instructions.
[0064] 2. Determination of the purity and concentration of RNA
[0065] Measure the optical density values OD260 and OD280 of RNA samples at 260nm and 280nm wavelengths respectively, and determine the RNA purity by calculating OD260 / OD280. Th...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com