SiRNA sequence against HCMV UL86 gene and applications
A sequence and gene technology, applied in the biological field, can solve the problems of gene integration risk, inapplicability to a large number of studies, high price, etc., and achieve the effect of effectively inhibiting the expression of UL86 gene mRNA and protein
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0012] Example 1 siRNA eukaryotic expression vector inhibits the expression of UL86-EGFP fusion protein in vitro
[0013] 1. Design of siRNA: According to the design principle of siRNA, search for the AA sequence at 100 nt downstream of the start codon AUG of UL86 mRNA, and the 21 nt sequence adjacent to its 3' end as a candidate target, and select the siRNA sequence with GC content of 40-55% , and compared with the human genome sequence through the Blast function of the GenBank database to ensure that there is no homology. The cDNA sequence of the finally selected siRNA is 5'-GCACGTCAGTTATCATCAACA-3', the GC content is 42.9%, corresponding to the 3161-3181 nucleotide site in UL86mRNA.
[0014] 2. Synthesis and preparation of shDNA required for expression of siRNA: the positive-sense strand sequence of shDNA required for expression of siRNA is:
[0015] 5'GATCC GCACGTCAGTTATCATCAACA TTCG TGTTGATGATAACTGACGT GC TTTTTA-3',
[0016] The antisense strand sequence is:
[00...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com