Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for improving doramectin preparing bacterium with genome reorganization technique

A doramectin and gene technology, applied in the field of cell biology, can solve the problems of difficult operation, cumbersome steps and high cost

Inactive Publication Date: 2012-11-07
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The problems of using the above-mentioned traditional markers are that the operation is difficult, the steps are cumbersome, and the cost is high. Some markers can cause damage to chromosomes, and some markers cannot be removed by simple means after being added, while resistance markers The presence of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving doramectin preparing bacterium with genome reorganization technique
  • Method for improving doramectin preparing bacterium with genome reorganization technique
  • Method for improving doramectin preparing bacterium with genome reorganization technique

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0087] The present invention establishes a new strain for preparing protoplast fusion for the first time - using marker plasmid for protoplast fusion screening. The method has the advantages of easy labeling and easy removal of the marker. After the resistance marker is removed, subsequent genetic operations, such as re-fusion, can be conveniently performed. The method of the present invention can be conveniently used for strain breeding and improvement based on gene shuffling technology, and has the advantages of simple operation, low cost and low equipment requirements.

[0088] Based on the method for preparing protoplast-fused strains, one or more protoplast fusion selections can be performed to obtain strains with a certain excellent trait (eg, high-yield doramectin).

Embodiment 1

[0236] Construction of doramectin-producing bacteria by fusion

[0237] 1. MMR78 bkdF gene disrupted strain

[0238] Using conventional PCR targeting technology, the bkdF gene of MMR78 was interrupted, and the interrupted position was from 5356308 to 5357522 bases of MMR78 chromosome.

[0239] After interruption, this segment was replaced by the oriT+spc gene, the sequence of which is shown in SEQ ID NO:1.

[0240] The transformed strain was obtained by spc resistance selection, and the obtained strain was spc resistant.

[0241] 2. MMR78 olmA1 gene disrupted strain

[0242] Using conventional PCR targeting technology, the olmA1 gene of MMR78 was interrupted, and the interrupted position was from 3607909 to 3626345 bases of MMR78 chromosome.

[0243] After interruption, this segment was replaced by the oriT+apra gene, the sequence of which is shown in SEQ ID NO:2.

[0244] The modified strain was obtained by apra-resistance selection, and the strain was apra-resistance.

...

Embodiment 2

[0252] Establishment of a Protoplast Fusion Mutagenesis Method for Marker Plasmids

[0253] 1. Construction of the marker vector pPFMtsr

[0254] The pIJ702 plasmid (purchased from the Institute of Microbiology, Chinese Academy of Sciences) was digested with the endonuclease BclI to obtain the tsr-melC gene carrying the BclI restriction site at both ends, and cloned into the pSP72 plasmid digested with BglII (the homocaudal enzyme of BclI). Inside, the pQC156 plasmid was obtained, which contains the t sr site, etc.

[0255] The total chromosome of Streptomyces coelicolor A3(2) (purchased from the Institute of Microbiology, Chinese Academy of Sciences) was used as the template, and the forward primer GAATTCGCAGCGTGAAGTAGTACC (SEQ ID NO: 7) and the reverse primer GAATTCGGCCCTCCTACTAGCGACC (SEQ ID NO: 8) were used for PCR amplification , to obtain the SCP2-oriC gene carrying EcoRI digestion sites at both ends, and clone it into the pQC156 plasmid digested with EcoRI to obtain th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for preparing strain which can generate protoplast fusion by using marked plasmid. The invention has the advantages that marks can be easily added and removed, thereby being convenient for performing breeding and improvement of the strain based on the gene shuffling technology. The invention also has the advantages that the operation is simple, the cost is low, the requirement for equipment is low, and the chromosome of the strain can not be damaged.

Description

technical field [0001] The present invention belongs to the field of cell biology; more particularly, the present invention relates to a method for preparing protoplast-fused strains, which can be used for breeding and improvement of various industrial strains (eg, doramectin-producing bacteria). Background technique [0002] In industrial microbial breeding, protoplast mutagenesis and protoplast fusion technology have been widely used and achieved good results. The mutagenesis fusion technology that combines the two has also been continuously applied and developed, especially the birth of the Genome Shuffling technology, which has brought new ideas to the breeding of industrial microorganisms. [0003] In general protoplast fusion, both parents are brought with recognizable selectable genetic markers to screen for fusions. However, the traditionally used selectable markers are mainly integration markers, drug resistance markers, auxotrophic markers and so on. The problems...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/03
Inventor 覃重军胡敏杰夏海洋
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More