Method for improving doramectin preparing bacterium with genome reorganization technique
A doramectin and gene technology, applied in the field of cell biology, can solve the problems of difficult operation, cumbersome steps and high cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0087] The present invention establishes a new strain for preparing protoplast fusion for the first time - using marker plasmid for protoplast fusion screening. The method has the advantages of easy labeling and easy removal of the marker. After the resistance marker is removed, subsequent genetic operations, such as re-fusion, can be conveniently performed. The method of the present invention can be conveniently used for strain breeding and improvement based on gene shuffling technology, and has the advantages of simple operation, low cost and low equipment requirements.
[0088] Based on the method for preparing protoplast-fused strains, one or more protoplast fusion selections can be performed to obtain strains with a certain excellent trait (eg, high-yield doramectin).
Embodiment 1
[0236] Construction of doramectin-producing bacteria by fusion
[0237] 1. MMR78 bkdF gene disrupted strain
[0238] Using conventional PCR targeting technology, the bkdF gene of MMR78 was interrupted, and the interrupted position was from 5356308 to 5357522 bases of MMR78 chromosome.
[0239] After interruption, this segment was replaced by the oriT+spc gene, the sequence of which is shown in SEQ ID NO:1.
[0240] The transformed strain was obtained by spc resistance selection, and the obtained strain was spc resistant.
[0241] 2. MMR78 olmA1 gene disrupted strain
[0242] Using conventional PCR targeting technology, the olmA1 gene of MMR78 was interrupted, and the interrupted position was from 3607909 to 3626345 bases of MMR78 chromosome.
[0243] After interruption, this segment was replaced by the oriT+apra gene, the sequence of which is shown in SEQ ID NO:2.
[0244] The modified strain was obtained by apra-resistance selection, and the strain was apra-resistance.
...
Embodiment 2
[0252] Establishment of a Protoplast Fusion Mutagenesis Method for Marker Plasmids
[0253] 1. Construction of the marker vector pPFMtsr
[0254] The pIJ702 plasmid (purchased from the Institute of Microbiology, Chinese Academy of Sciences) was digested with the endonuclease BclI to obtain the tsr-melC gene carrying the BclI restriction site at both ends, and cloned into the pSP72 plasmid digested with BglII (the homocaudal enzyme of BclI). Inside, the pQC156 plasmid was obtained, which contains the t sr site, etc.
[0255] The total chromosome of Streptomyces coelicolor A3(2) (purchased from the Institute of Microbiology, Chinese Academy of Sciences) was used as the template, and the forward primer GAATTCGCAGCGTGAAGTAGTACC (SEQ ID NO: 7) and the reverse primer GAATTCGGCCCTCCTACTAGCGACC (SEQ ID NO: 8) were used for PCR amplification , to obtain the SCP2-oriC gene carrying EcoRI digestion sites at both ends, and clone it into the pQC156 plasmid digested with EcoRI to obtain th...
PUM
Property | Measurement | Unit |
---|---|---|
wavelength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap