Recombinant human iron-regulatory hormone adenovirus, preparation method and application thereof

An adenovirus and hepcidin technology, applied in the field of genetic engineering, can solve the problems of small protein molecular weight, limited application scope, difficult preparation and purification, etc., and achieves the effects of high transfection rate, good operability and simple process flow

Inactive Publication Date: 2009-02-04
THE HONG KONG POLYTECHNIC UNIV SHENZHEN RES INST
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the small molecular weight of the protein and four disulfide bonds, hepcidin has problems such as difficulty in preparation and purification and easy degradation, which greatly limits its application range as a drug.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human iron-regulatory hormone adenovirus, preparation method and application thereof
  • Recombinant human iron-regulatory hormone adenovirus, preparation method and application thereof
  • Recombinant human iron-regulatory hormone adenovirus, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] hepcidin gene insertion recombination

[0069] Such as figure 1 As shown, pTrack-CMV is the shuttle plasmid of recombinant adenovirus. We connected the two ends of the hepcidin gene with Bgl II and Sal I restriction sites, and added a polyA tail as a termination signal region. Digest the hepcidin gene and the shuttle plasmid, and connect and transform them with T4 ligase. After screening, the correct clone is obtained and sent to a sequencing company for sequencing identification.

[0070] Ad-hepc structure: The recombinant human hepcidin adenovirus (Ad-hepc) vector lacks the E1 region, and cannot be packaged into mature virus particles in ordinary cells, and is a defective virus. Human hepcidin (hepcidin) gene was the target gene. We inserted the human secretory hepcidin gene into the genome of the virus, with double CMV as its promoter, green fluorescent protein (GFP) as its marker, and the downstream polyA tail as its termination signal region.

Embodiment 2

[0072] Preparation of recombinant human hepcidin adenovirus

[0073] The production process of recombinant human hepcidin adenovirus (Ad-hepc) includes: recombinant vector construction, vector linearization preparation, transfection of HEK293 cells, expanded culture, separation and purification, freeze-drying and packaging preparations. Specifically see the following detailed description and its production process flow chart (see figure 2 ).

[0074] 1. Acquisition of the target gene hepcidin

[0075] Using human genome cDNA as a template, Pfu high-fidelity enzyme PCR amplification. The thermal amplification conditions of PCR were denaturation at 95°C for 5 minutes, 30 cycles at 95°C for 80s, 100s at 58°C, and 120s at 72°C, and finally, incubation at 72°C for 5 minutes. The product is about 450bp.

[0076] Its primer sequence is:

[0077] Upstream primer (Seq ID No.2):

[0078] CTCAC AGATCT GACAGAAGGCAAGATGGCACTAAG

[0079] Downstream primer (Seq ID No.3):

[0080] TC...

Embodiment 3

[0177] Ad-hepc system infection and expression experiment

[0178] 1. Inoculate C6 cells 1.5X10 7 Cells were cultured in 9 cm (Corning), 37 ° C, 5% CO 2 Culture overnight;

[0179] 2. Change 5ml serum-free medium before infection;

[0180] 3. Add 0.5ul of the purified virus prepared in Example 2 to each petri dish;

[0181] 4. Culture 0h, 6h, 12h, 24h, 48h respectively

[0182] 5. Collect cells according to time points;

[0183] 6. Real-time PCR quantitative detection of hepcidin expression at different time points;

[0184] 7. Statistical results.

[0185] The result is as image 3 , 4 As shown, the expression of hepcidin has reached 8.1 times that of the blank control group at about 12 hours, and the expression continues.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a recombinant human hepcidin adenovirus (Ad-hepc), which contains human hepcidin gene and adenovirus vector. The present invention also discloses a preparation of the recombinant human hepcidin adenovirus and an application thereof. The present invention utilizes defective adenovirus to deliver the human hepcidin gene into the tissue cells of the body, so that the virus can express hepcidin protein in the body of a patient.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a recombinant human hepcidin adenovirus capable of autonomously expressing hepcidin protein in organisms by using a recombinant adenovirus vector to carry a human hepcidin gene, and its preparation method and application. Background technique [0002] Hepcidin is a cysteine-rich antibacterial polypeptide. In 2001, Park et al. first isolated this polypeptide from human urine and named it hepcidin. Human hepcidin contains three constituent forms of 20, 22 and 25 amino acid polypeptides. The 25 amino acid polypeptide is the main form of hepcidin. The hepcidin gene is located on human chromosome 19, consists of three exons and two introns, and the length of the transcribed mRNA is about 0.4kb. The analysis results of Northern Bolt showed that the hepcidin gene was specifically expressed in the liver, with little expression in the heart, spinal cord, and lung, and almo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/861C12N15/12A61K48/00
Inventor钱忠明葛啸虎柯亚汪程远
OwnerTHE HONG KONG POLYTECHNIC UNIV SHENZHEN RES INST