Blood vessel target liposome carrier mediated by fiber forming growth factor receptor and preparation method and use thereof
A technology of targeting liposomes and liposomes, applied in the field of biomedicine, can solve the problems of low efficiency of gene introduction system, lack of effective regulation of therapeutic genes, lack of targeting, etc., and achieves improved transfection efficiency and stability, The effect of reduced in vivo clearance and improved drug distribution
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] The selection and optimization of the liposome formula of embodiment one
[0057] Materials: 1,2-dioleoyl-3-trimethylammoniopropane (DOTAP) was purchased from Avanti Company; cholesterol (Chol) was purchased from Sigma Company; tbFGF was self-constructed and expressed with a purity greater than 99%.
[0058] Construction and expression of tbFGF: analyze human bFGF sequence, design primers for amplifying tbFGF (aa.30-115), introduce restriction endonuclease Kpn I restriction endonuclease Kpn I enzyme cutting site and enterokinase (EK enzyme) cutting site at the 5' end of upstream primer site, the 5' end of the downstream primer was introduced with a restriction endonuclease Hind III site, which was synthesized by Shanghai Handsome Biotechnology Co., Ltd.
[0059] Upstream primer (Seq ID No.2):
[0060] 5'GG GGTACC AAGCGGCTGTACTGCAAAAACG 3'.
[0061] Downstream primer (Seq ID No 3):
[0062] 5'CCC AAGCTT AGTAAGTATTGTAGTTATTAGATTC 3'.
[0063] Using pBLAST45-hbFG...
Embodiment 2
[0072] Example 2 Further optimization of the preparation process conditions for targeted blank liposomes
[0073] During the whole process, the composite of blank liposome and tbFGF polypeptide mainly depends on the electrostatic force between the positive charge of cationic liposome and the negative charge of tbFGF polypeptide. Incubate to obtain targeting blank liposomes. In order to obtain stable targeted blank liposomes, the complex conditions of our tbFGF polypeptide and cationic liposomes were optimized. Among them, the times of freezing and thawing had a great influence on the encapsulation efficiency of tbFGF.
[0074] First, the effect of freeze-thaw times on the binding of tbFGF was investigated. After the targeting blank liposomes were combined with different ratios of tbFGF, the changes in encapsulation efficiency after repeated freezing and thawing for 1, 2, 3, 4, 5, and 6 times are shown in Table 1. The data showed that at the beginning of freezing and thawing...
Embodiment 3
[0080] Example 3, the preparation process of targeting liposome-encapsulated plasmid DNA or adenovirus
[0081]The preparation of targeting liposome gene complex is formed by self-assembly by incubating targeting blank liposome with appropriate ratio of plasmid DNA or adenovirus.
[0082] Targeting blank liposome obtained in Example 2 was mixed with plasmid DNA at a ratio of 1:3 (weight ratio), and incubated overnight at 4°C to obtain a targeting liposome-plasmid DNA complex.
[0083] Similarly, the targeting blank liposome obtained in Example 2 is proportional to the recombinant adenovirus: 2.5×10 9 VP recombinant adenovirus / mg cationic liposomes were mixed and incubated at room temperature for 10-30 minutes to obtain the targeted liposome adenovirus complex.
PUM
| Property | Measurement | Unit |
|---|---|---|
| particle diameter | aaaaa | aaaaa |
| particle diameter | aaaaa | aaaaa |
| particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 