Blood vessel target liposome carrier mediated by fiber forming growth factor receptor and preparation method and use thereof

A technology of targeting liposomes and liposomes, applied in the field of biomedicine, can solve the problems of low efficiency of gene introduction system, lack of effective regulation of therapeutic genes, lack of targeting, etc., and achieves improved transfection efficiency and stability, The effect of reduced in vivo clearance and improved drug distribution

Inactive Publication Date: 2012-04-04
SICHUAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the biggest problem of ordinary cationic liposomes is low transfection efficiency and poor targeting
The main reason is that (1) the efficiency of the gene introduction system is low and lacks targeting; (2) some gene therapy vectors are randomly inserted and integrated into the chromosome of the host cell, which may cause potential danger of insertion mutation and malignant transformation of cells; (3) Lack of effective regulation of introduced therapeutic genes, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Blood vessel target liposome carrier mediated by fiber forming growth factor receptor and preparation method and use thereof
  • Blood vessel target liposome carrier mediated by fiber forming growth factor receptor and preparation method and use thereof
  • Blood vessel target liposome carrier mediated by fiber forming growth factor receptor and preparation method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] The selection and optimization of the liposome formula of embodiment one

[0057] Materials: 1,2-dioleoyl-3-trimethylammoniopropane (DOTAP) was purchased from Avanti Company; cholesterol (Chol) was purchased from Sigma Company; tbFGF was self-constructed and expressed with a purity greater than 99%.

[0058] Construction and expression of tbFGF: analyze human bFGF sequence, design primers for amplifying tbFGF (aa.30-115), introduce restriction endonuclease Kpn I restriction endonuclease Kpn I enzyme cutting site and enterokinase (EK enzyme) cutting site at the 5' end of upstream primer site, the 5' end of the downstream primer was introduced with a restriction endonuclease Hind III site, which was synthesized by Shanghai Handsome Biotechnology Co., Ltd.

[0059] Upstream primer (Seq ID No.2):

[0060] 5'GG GGTACC AAGCGGCTGTACTGCAAAAACG 3'.

[0061] Downstream primer (Seq ID No 3):

[0062] 5'CCC AAGCTT AGTAAGTATTGTAGTTATTAGATTC 3'.

[0063] Using pBLAST45-hbFG...

Embodiment 2

[0072] Example 2 Further optimization of the preparation process conditions for targeted blank liposomes

[0073] During the whole process, the composite of blank liposome and tbFGF polypeptide mainly depends on the electrostatic force between the positive charge of cationic liposome and the negative charge of tbFGF polypeptide. Incubate to obtain targeting blank liposomes. In order to obtain stable targeted blank liposomes, the complex conditions of our tbFGF polypeptide and cationic liposomes were optimized. Among them, the times of freezing and thawing had a great influence on the encapsulation efficiency of tbFGF.

[0074] First, the effect of freeze-thaw times on the binding of tbFGF was investigated. After the targeting blank liposomes were combined with different ratios of tbFGF, the changes in encapsulation efficiency after repeated freezing and thawing for 1, 2, 3, 4, 5, and 6 times are shown in Table 1. The data showed that at the beginning of freezing and thawing...

Embodiment 3

[0080] Example 3, the preparation process of targeting liposome-encapsulated plasmid DNA or adenovirus

[0081]The preparation of targeting liposome gene complex is formed by self-assembly by incubating targeting blank liposome with appropriate ratio of plasmid DNA or adenovirus.

[0082] Targeting blank liposome obtained in Example 2 was mixed with plasmid DNA at a ratio of 1:3 (weight ratio), and incubated overnight at 4°C to obtain a targeting liposome-plasmid DNA complex.

[0083] Similarly, the targeting blank liposome obtained in Example 2 is proportional to the recombinant adenovirus: 2.5×10 9 VP recombinant adenovirus / mg cationic liposomes were mixed and incubated at room temperature for 10-30 minutes to obtain the targeted liposome adenovirus complex.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
particle diameteraaaaaaaaaa
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the biology medicine field, and relates to a fiber growth factor receptor (FGFR)-mediated vascular targeted liposome carrier, a preparation method thereof and an application thereof. The invention aims at solving the technical problem of proving a cationic liposome with high transfection efficiency and tumor vascular targeting. The targeted liposome is prepared by using the components with the following mixture ratios: the mixture ration of DOTAP, cholesterol and tb FGF polypeptide is: the mol ratio of the DOTAP to the cholesterol equals to 2:1-2, and the weight of the tb FGF polypeptide is 10-80 percent of the total weight of the DOTAP and the cholesterol. The liposome can be combined with the FGF receptor (FGFR) on the surface of tumor new-generated vascular cells particularly, and can realize the preparation method thereof and the application of tumor vascular targeting therapy by wrapping up various micromolecule anti-tumor drugs, therapy genes and adenoviral vectors carrying therapy genes.

Description

technical field [0001] The invention belongs to the field of biomedicine, and specifically relates to a fibroblast growth factor receptor (FGFR)-mediated targeting liposome carrier, a preparation method and application. Background technique [0002] Nanotechnology is a new technology that was born in the late 1980s and rose rapidly. Together with information science and life science, it is called the three pillar sciences of the 21st century. At present, many countries in the world have listed nanometer research as a national key development field. Nanobiotechnology is one of the research hotspots of nanotechnology. my country has launched a major special project of "Nanobiology and Medical Technology" during the "Tenth Five-Year Plan" 863 Plan and the Science and Technology Research Plan and the "Eleventh Five-Year Plan" 863 and 973 Plans. A series of advanced original achievements have been made in nano drug preparations. [0003] Nanotechnology is a science that studies ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K38/18A61K9/127A61K47/42A61K47/48A61P35/00A61K31/337A61K31/4745A61K31/704
Inventor陈俐娟杨莉魏于全赵霞
OwnerSICHUAN UNIV