Trichoderma phospholipase A2 and gene for expressing thereof
A technology of Trichoderma phospholipid and gene, which is applied in the field of agricultural biology, can solve the problems such as the enhanced induction of plant disease resistance by Trichoderma, and achieve the effects of reducing the loss of corn curvaceous leaf spot disease and increasing yield.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0028] Example 1 The method of efficient prokaryotic expression and purification of Trichoderma phospholipase A2
[0029] The cDNA of the phospholipase A2 gene was amplified from the template of the reverse-transcribed cDNA of Trichoderma. After the gel was recovered, it was double-digested with BamH1 and EcoR1 and then inserted into the same digested PET30a (Nevogen) vector. Transform Rossete (Nevogen) competent, select positive colonies, and verify the correct reading frame by sequencing. Use a toothpick to pick colonies into 50ug / ml concentration Kna, 34ug / ml 5ml LB test tube, 37°C, 200 rpm, overnight culture. On the second day, add 200ml LB of the same antibiotic concentration into a 1-liter Erlenmeyer flask at a ratio of 1:100, add IPTG to a final concentration of 1mM IPTG 3 hours later, and induce for 4 hours at 37°C (at this time, the protein in the supernatant is the most). Centrifuge at 4000 rpm for 10 minutes, ultrasonic at 70% maximum power, and crush for 20 minut...
Embodiment 2
[0030] Example 2 The method of using the gene expressing Trichoderma phospholipase A2 to construct a deletion mutant to prevent and treat curved cell leaf spot in maize
[0031] Design primers PAF1 (5'ATGCAAATGCACAGCATCTC) and PAF2 (5'AGCTTATCGATACCGTCGACCTCGAGGACGGCGATGTTGTTGAAGGT), PAF3 (5'GGTGGAGCTCCAGCTTTTGTTCCCTTTAATCTCACGGCTGCTCAACA) and PAF4 (5'GGGAAAATCGACGCAGAGAC) to amplify the sequence of the upstream and downstream primers Ghy1TCCCCCG5'ACGGAG of about 1Kb of the gene at the same time using TCG ) and hyg2 (5'AAAGGGAACAAAAAGCTGGAG) to amplify the hygromycin gene, and use the method of fusion PCR to obtain a fusion fragment containing the hygromycin gene in the middle and the upstream and downstream sequences on both sides. Prepare Trichoderma protoplasts, the method is as follows: insert 1ml10 7 Spores / ml into liquid potato medium (1 liter of PDB: 20g glucose, 200g potatoes;), culture at 28°C, 180 rpm for 24 hours, filter with three layers of lens-cleaning paper, rin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com