Unlock instant, AI-driven research and patent intelligence for your innovation.

Trichoderma phospholipase A2 and gene for expressing thereof

A technology of Trichoderma phospholipid and gene, which is applied in the field of agricultural biology, can solve the problems such as the enhanced induction of plant disease resistance by Trichoderma, and achieve the effects of reducing the loss of corn curvaceous leaf spot disease and increasing yield.

Inactive Publication Date: 2009-03-18
SHANGHAI JIAO TONG UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Trichoderma is an important plant biocontrol fungus. It mainly induces plant system disease resistance to play a biocontrol role through reparasitism. At present, the PLA2 gene has not been cloned in Trichoderma, and the use of cloned genes to regulate Trichoderma enhancement has not yet been carried out. Study on Inducing Plant Disease Resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 The method of efficient prokaryotic expression and purification of Trichoderma phospholipase A2

[0029] The cDNA of the phospholipase A2 gene was amplified from the template of the reverse-transcribed cDNA of Trichoderma. After the gel was recovered, it was double-digested with BamH1 and EcoR1 and then inserted into the same digested PET30a (Nevogen) vector. Transform Rossete (Nevogen) competent, select positive colonies, and verify the correct reading frame by sequencing. Use a toothpick to pick colonies into 50ug / ml concentration Kna, 34ug / ml 5ml LB test tube, 37°C, 200 rpm, overnight culture. On the second day, add 200ml LB of the same antibiotic concentration into a 1-liter Erlenmeyer flask at a ratio of 1:100, add IPTG to a final concentration of 1mM IPTG 3 hours later, and induce for 4 hours at 37°C (at this time, the protein in the supernatant is the most). Centrifuge at 4000 rpm for 10 minutes, ultrasonic at 70% maximum power, and crush for 20 minut...

Embodiment 2

[0030] Example 2 The method of using the gene expressing Trichoderma phospholipase A2 to construct a deletion mutant to prevent and treat curved cell leaf spot in maize

[0031] Design primers PAF1 (5'ATGCAAATGCACAGCATCTC) and PAF2 (5'AGCTTATCGATACCGTCGACCTCGAGGACGGCGATGTTGTTGAAGGT), PAF3 (5'GGTGGAGCTCCAGCTTTTGTTCCCTTTAATCTCACGGCTGCTCAACA) and PAF4 (5'GGGAAAATCGACGCAGAGAC) to amplify the sequence of the upstream and downstream primers Ghy1TCCCCCG5'ACGGAG of about 1Kb of the gene at the same time using TCG ) and hyg2 (5'AAAGGGAACAAAAAGCTGGAG) to amplify the hygromycin gene, and use the method of fusion PCR to obtain a fusion fragment containing the hygromycin gene in the middle and the upstream and downstream sequences on both sides. Prepare Trichoderma protoplasts, the method is as follows: insert 1ml10 7 Spores / ml into liquid potato medium (1 liter of PDB: 20g glucose, 200g potatoes;), culture at 28°C, 180 rpm for 24 hours, filter with three layers of lens-cleaning paper, rin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a trichoderma phospholipase A2 and a gene for expressing the same. The invention belongs to the field of agricultural biotechnology. The invention provides sequences of the trichoderma phospholipase A2 (PLA2) amino acid and nucleotide, and constructs efficient prokaryotic expression of the trichoderma phospholipase A2 and purifies system; the invention constructs deletion mutants of the gene, and uses the gene to prevent and control the curvularia leaf spot and achieves good effect. The invention firstly gains the trichoderma phospholipase A2 from filamentous fungi, and clones the gene which expresses the same. The efficient method for gaining the trichoderma phospholipase A2 provides the possibility of producing enzyme preparation. The trichoderma phospholipase A2 has double functions of both esterase and phospholipase A2, which indicates the trichoderma phospholipase A2 has good application value in industrial catalysis; and the function of the deletion mutants of the gene on preventing and controlling the curvularia leaf spot provides new application, and can greatly reduce curvularia leaf spot disease to improve maize yield.

Description

technical field [0001] The present invention relates to Trichoderma phospholipase A2 and the gene expressing the enzyme. At the same time, it provides a method for obtaining the high-efficiency prokaryotic expression and affinity tag purification of the enzyme, and a method for constructing the gene-deleted Trichoderma mutant to prevent and control corn Curvularia leaf spot. The invention belongs to the field of agricultural biotechnology. Background technique [0002] Phospholipids are a class of facultative molecules with hydrophilic and hydrophobic properties, and are the main components of cell biomembranes. Phospholipase is an enzyme that can hydrolyze phospholipids into various phosphatidic acids and amino alcohols. According to the different parts of phospholipid hydrolysis by phospholipases, phospholipases can be divided into four categories: phospholipases A1, A2, C, and D. Among them, phospholipase A2 (PLA2) specifically hydrolyzes the ester bond at the sn-2 posi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/16C12N15/55C12N15/70A01N63/04A01P3/00
Inventor 王兵陈捷刘力行
Owner SHANGHAI JIAO TONG UNIV