Novel Bt protein Cry53Ab1, coding gene thereof and use
A technology of bt protein and gene, applied in the fields of application, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Cloning of cry53Ab1 gene
[0027] The present invention is a new strain of Bacillus thuringiensis isolated from the soil in the virgin forest area of Muchuan, Sichuan Province. The strain has been in the General Microbiology Center of the China Microbial Culture Collection and Management Committee on October 21, 2008 (Address: Beijing No. 3, Datun Road, Chaoyang District, China, deposited by Institute of Microbiology, Chinese Academy of Sciences, 100101), classified and named as Bacillus thuringiensis, and deposited as CGMCC No.2719.
[0028] In this example, the full-length sequence of cry53Ab1 gene was cloned by the following method.
[0029] The total DNA of the strain BtMC28 was extracted using a genomic DNA purification kit (purchased from Cybersun). Design primer sequence as follows:
[0030] P1: 5’ATGAATTCATATCAAAATAAAAATG 3’
[0031] P2: 5’TTATTCGACAAATAAACTATTTACA 3’
[0032] PCR reaction system:
[0033] 10×buffer 2.5μl
[0034] MgCl 2 (25mM) 1.5μl
[0035] Ta...
Embodiment 2
[0041] Example 2 Expression of cry53Ab1 gene and determination of insecticidal activity
[0042] According to the sequences at both ends of the open reading frame of cry53Ab1 gene, a pair of specific primers cry5 3F: 5′-GCG was designed and synthesized CATATG (NdeI)ATGAATTCATATCAAAATAAAAATG-3, cry5 3R: 5′-CG GAATTC (EcoR I)TTATTCGACAAATAAACTATTTACA-3', primers Nde I and EcoR I restriction sites at the 5'end respectively. Using BtMC28 total DNA as template for amplification, the reaction procedure and reaction system were the same as in Example 1. The amplified product was double digested with Nde I and EcoR I, and the digested product was the same as the vector pET-30a after double digestion. (+) After connecting, transforming E.coli DH5α competent cells, extracting their plasmids, enzyme digestion electrophoresis, and verifying that the inserted fragment size meets the expected purpose ( figure 2 ), and then transferred to the recipient bacteria E.coli.BL21(DE3). The recombi...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 