Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific double-strand RNA binding protein chimera and application thereof in virus infectious diseases

A protein-binding and specific technology, applied in the field of protein chimeras, can solve the problems of lack of specific treatment methods

Inactive Publication Date: 2009-09-09
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the development of molecular virology, although the mechanism of viral infection has been deeply understood, due to the variety of viruses and the limitations of diagnostic techniques in clinical practice, only a small number of viral infections can be diagnosed and targeted treatment
Some serious viral infections, such as AIDS, SARS, avian influenza and Prion virus infection (spongiform encephalopathy), currently lack specific treatments

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific double-strand RNA binding protein chimera and application thereof in virus infectious diseases
  • Specific double-strand RNA binding protein chimera and application thereof in virus infectious diseases
  • Specific double-strand RNA binding protein chimera and application thereof in virus infectious diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0136] Example 1: Research on the antiviral effect of double-stranded RNA-ADAR1-PKR-NF90 complex

[0137] (1) The role of ADAR1 in binding to double-stranded RNA-PKR signaling

[0138] 1. The relationship between ADAR1 editing double-stranded RNA and double-stranded RNA-PKR signal regulation

[0139] 1) Culture of ADAR1+ / +, ADAR1+ / - and ADAR1- / - neuron cells: ADAR1+ / +, ADAR1+ / - and ADAR1- / - mice at 11-12 days of pregnancy were routinely anesthetized, and the fetuses were taken out under aseptic conditions. Carefully peel off the cerebellar cortex, remove the meninges and vascular tissues, cut into 1mm-sized tissue pieces, and then add 0.125% trypsin to digest at 37°C for 30min. Add DMEM culture solution containing 10% fetal bovine serum to stop the digestion for 10 minutes, pipette to form a cell suspension, and inoculate to a polylysine-coated cell culture plate. After 7 days of in vitro culture, the following experiments were carried out.

[0140] 2) Construction of pENTR / U...

Embodiment 2

[0194] Example 2: Constructing expression vectors of protein chimeras comprising different double-stranded RNA sensor sequences, apoptosis signals and protein transduction domains and extracting proteins

[0195] 1. Construction of four different protein chimeras: the double-stranded RNA sensor sequences of four different protein chimeras are NF90, PACT, ADAR1 and PKR respectively (see figure 2 shown). The specific connection method is as follows: First, the cDNAs of NF90, PACT, ADAR1 and PKR are amplified from the human cDNA gene library by RT-PCR, and then XhoI and KpnI are added to the four different double-stranded RNA sensor sequences by PCR Restriction sites for enzyme cutting; at the same time, enzyme cutting sites for XhoI and KpnI are also added to the apoptosis signal; two oligonucleotides agctt ggatcc tacgcccgtgccgccgcccgtcaggcccgtgccagtggt and ccat ctcgag accactggcacgggcctg was amplified by PCR and double-digested with BamHI and XhoI to obtain the cDNA coding ...

Embodiment 3

[0198] Example 3: Inhibitory effect of four different protein chimeras on HEK293 cells infected by adenovirus

[0199] 1. Adenovirus infection: After HEK293 or 293T cells were grown on a six-well plate for 8 hours, they were infected with fluorescently labeled recombinant adenovirus for 30-60 minutes, washed twice with warm PBS, and then washed with 10% FBS DMEM culture medium for 12 hours. Observe the cells after virus infection with a fluorescence microscope, observe the titer of 293T infected with the virus by the method of virus gradient dilution, and count the GFP positive cells under the fluorescence microscope after 24 hours of infection (see image 3 shown).

[0200] 2. Antiviral analysis in vitro: The antiviral proteins purified from the above four different protein chimeras were added to the culture medium before, during or after infection, and were tested by fluorescence after 2 days, 1 week and 10 days after infection respectively. The infection of the virus was ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a specific double-strand RNA binding protein chimera and the application thereof in curing and preventing virus infectious diseases, in particular to four protein chimeras formed by double-strand RNA receptor sequences of NF 90, PACT, ADAR1 and PKR and one or a plurality of applications thereof in curing and preventing the virus infectious diseases. The specific double-strand RNA binding protein chimera is characterized in that a protein transduction signal, a double-stranded RNA receptor and a cell apoptosis signal are sequentially connected by a DNA recombinant method to form the specific double-strand RNA binding protein chimera which is respectively expressed in procaryotic cells and eukaryotic cells. The specific double-strand RNA binding protein chimera can be used for curing and preventing the virus infectious diseases and is taken as a protein drug treatment tool on the level of mammalian cells.

Description

technical field [0001] The present invention relates to the application of double-stranded RNA binding protein chimera in the treatment or prevention of viral infectious diseases, in particular to the application of four protein chimeras composed of double-stranded RNA sensor sequences NF90, PACT, ADAR1 and PKR in the treatment and prevention of viruses One or more applications in infectious diseases. Background technique [0002] Viral infection is a common disease that threatens human life and health. With the development of molecular virology, although the mechanism of viral infection has been deeply understood, due to the variety of viruses and the limitation of diagnostic techniques in clinical practice, only a small number of viral infections can be diagnosed and targeted treatment. Some serious viral infections, such as AIDS, SARS, avian influenza and Prion virus infection (spongiform encephalopathy), etc., currently lack specific therapeutic means. Therefore, if a ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/63A61K38/17A61P31/12
Inventor 费舟杨静华樊代明汪爱勤程光晁晓东
Owner FOURTH MILITARY MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com