Unlock instant, AI-driven research and patent intelligence for your innovation.

Constitutive expression promoter in escherichia coli and applications in escherichia coli

A constitutive expression, Escherichia coli technology, applied in the field of industrial expression production, can solve the problems of not being able to regulate tightly, unfavorable accumulation of expression products, and difficulty in rapid temperature conversion

Inactive Publication Date: 2009-10-21
GUANGXI UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The regulation of the heat-inducible (λPL) promoter is dependent on mutant lacI strains. Although the wild-type lacI gene is also heat-inducible, it cannot be tightly regulated and cannot be used in lacIq strains because changes in temperature cannot suppress the lacI gene. Stringent inhibition caused by overexpression of the repressor protein, therefore, this system can only be used to produce some proteins that are not harmful to the host bacteria
Temperature-inducible promoters have disadvantages that are not conducive to large-scale industrial expression. For example, it is very difficult to quickly switch temperatures in large fermenters, which affects the effect of induced expression. Induction under growth temperature conditions tends to cause expression products to form inactive inclusion bodies, and at the same time, proteases in the host are easily activated to degrade the expressed target protein under high temperature conditions, which is not conducive to the accumulation of expression products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Constitutive expression promoter in escherichia coli and applications in escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0034] The present invention is described in detail below by embodiment:

[0035] The materials used in the embodiments of the present invention include: Escherichia coli (Escherichia coli) strains, the vector pMD18-T Vector cloning vector was purchased from TaKaRA; reagents such as restriction endonucleases and modifying enzymes were purchased from TaKaRA, MBI; Licheniformis strains were purchased from the Industrial Culture Collection.

[0036] 1. Predict and screen candidate promoter DNA sequences

[0037]The metagenomic library of soil uncultivated microorganisms contains a large number of unknown DNA sequences. The metagenomic library of soil uncultivated microorganisms constructed by the inventors has obtained a large number of new DNA sequences through random sequencing, and there may be target promoters we need in these sequences It is possible to find the promoter DNA sequence we need through prediction and experimental research. Usually, the size of prokaryotic pro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a DNA for constitutive expression promoter Pinv in escherichia coli, which has information of SEQ ID NO.1. The sequence information is NO.:1, the sequence length is 51 base pairs, the sequence type is nucleic acid, the chain type is double chain, the topology is linearity, the molecule type is gene group DNA, the hypothesis is NO, the antisense is NO, the source is soil-uncultured microorganism and the sequence is aacattgaggcaacgacaaggtcgattctgctatccttgaggaggctcctc. The promoter can realize the high-level expression of foreign gene in the escherichia coli without induction of chemical and physical conditions. The obtained promoter can be used for expressing the foreign gene in the escherichia coli and can be used for production of protein.

Description

technical field [0001] The invention relates to a method for constitutively expressing a promoter in Escherichia coli, which belongs to the research field of gene expression technology. The invention relates to a method for further utilizing the promoter for gene expression and industrial expression production of useful proteins. Background technique [0002] Gene expression technology is the core technology of genetic engineering technology. Cloning genes to express encoded proteins can be used for structural and functional research. Some proteins with specific biological activities are of great application value in medicine and even in industry. By cloning its gene and artificially controlling its expression, a large amount of protein of the target gene can be obtained at low cost. Cloned genes can be expressed in different host cells. So far, many gene expression systems have been established, including prokaryotic gene expression systems and eukaryotic gene expression sy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/70C12R1/19C12R1/00C12N15/113
Inventor 韦宇拓黄日波杜丽琴
Owner GUANGXI UNIV