Gene for identifying quality of cotton fiber according to relative expression value
A relative expression, cotton fiber technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of increased expression, low strength, and short cotton fiber length.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0027] Example 1. GhCAD6 expression level and real-time quantitative method verification in upland cotton breeding materials
[0028] 1 RNA extraction and concentration normalization
[0029] In 2007, 5 good-quality and 5 poor-quality cotton breeding materials were randomly selected in the field. The above method was used to sample 15 days after flowering, and the total RNA of 10 materials was extracted. The integrity of the RNA was detected by electrophoresis and Eppendorf biospectrophotometer. Adjust the RNA concentration of the sample to 0.25 μg / μl for stability and purity. Figure 4 It is the RNA agarose gel electrophoresis picture of 10 upland cotton advanced materials. Two very clear bands of 28S and 18S can be seen, indicating that the RNA is well extracted, not degraded, and free of DNA contamination.
[0030] The primer sequence of the specific region of 2GhCAD6 gene:
[0031] GhCAD6-F: 5'ACCCCTCTTCAGTTTTGTTACCCCC 3'
[0032] GhCAD6-R: 5'GCTTCCAGCAACATCCACGAC 3' ...
example 2
[0044] Example 2. Interannual expression of GhCAD6 in upland cotton advanced materials
[0045] Among the high-generation breeding materials, 12 materials were selected and planted for two consecutive years. They were sampled 15 days after flowering in 2007 and 2008, and total RNA was extracted. QuantumRNA TM Relative quantitative method of 18S internal standard was used to detect the relative expression of GhCAD6 gene in these 12 materials in the past two years ( Figure 8 ), the first 6 materials (No. 1-6) represent high-quality materials, whose length is greater than 30mm, and the strength is greater than 24CN / tex, and the last 6 materials (No. 7-12) represent poor-quality materials, and their length is less than 29mm. The strength is less than 21CN / tex. It can be seen from the figure that the PCR amplification product bands of the first six materials GhCAD6 are relatively dark, and the ratio is lower compared with the 18S internal standard band, indicating that the relat...
example 3
[0046] Example 3. The relative expression level and quality of GhCAD6, a high-generation material for upland cotton breeding
[0047] Randomly select 10 samples from the high-generation materials for breeding, sample 15 days after flowering, extract total RNA, and use QuantumRNA TM 18S internal standard relative quantification method was used to detect the relative expression of these 10 materials ( Figure 10 ), and used the previous detection of low expression and good quality (70831) and low expression and poor quality (Xie 1) as controls. Cotton fibers picked in the middle of the cotton plant at the mature stage were sent to the Agricultural Products Quality Inspection Center of the Ministry of Agriculture (Urumqi) for detection with the Uster HVI fiber detection system, and the detection results (Table 2) showed that the material with low expression in the previous detection (No. 1) and the expression The high material (No. 2) showed stable performance in this test; mat...
PUM
Property | Measurement | Unit |
---|---|---|
length | aaaaa | aaaaa |
length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com