Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for producing glutathione by use of metabolic engineering bacteria

A glutathione and bacterial strain technology, applied in the field of bioengineering, can solve the problems of high cost and energy consumption, low raw material utilization rate, low glutathione output, etc., to reduce production cost and energy consumption, and improve raw material utilization rate effect

Inactive Publication Date: 2009-12-30
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI +1
View PDF1 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, using yeast culture to produce glutathione alone has problems such as low raw material utilization rate, high cost and energy consumption, especially the low yield of glutathione and high production cost. Therefore, it is necessary to improve it , to overcome the above drawbacks

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing glutathione by use of metabolic engineering bacteria
  • Method for producing glutathione by use of metabolic engineering bacteria
  • Method for producing glutathione by use of metabolic engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 , Construction of co-expression plasmid

[0037] 1.1. Primer design

[0038] According to the GSH1 and GSH2 sequences reported by Genebank, the following 4 primers were designed:

[0039] GSH1UP: ATCGAT ACGATGGGACTCTTAGCTTTGGG;

[0040] GSH1DNM: CAATTGTTAACATTTGCTTTCTATTG;

[0041] GSH2UP: TTCGAA ACGATGGCACACTATCCACCTTC;

[0042] GSH2DNE:GAATTCCTAGTAAAGAATAATACTGTC.

[0043] Among them, GSH1UP and GSH1DNM are used to amplify the GSH1 coding region; GSH2UP and GSH2DNE are used to amplify the GSH2 coding region; the underlines on GSH1UP and GSH2UP indicate the AsuII restriction site and ClaI restriction site introduced on GSH1UP and GSH2UP respectively .

[0044] 1.2. PCR amplification of GSH1 and GSH2 sequences

[0045] The genome of Saccharomyces cerevisiae BY4742 was extracted.

[0046] Then, using the Saccharomyces cerevisiae BY4742 genome as a template, the primer pair GSH1UP and GSH1DNM and the primer pair GSH2UP and GSH2DNE designed in step 1...

Embodiment 2

[0073] Example 2 , Construction of glutathione-producing Pichia strains

[0074] Escherichia coli carrying the plasmid pGKG1G2 was grown overnight, and the pGKG1G2 plasmid was extracted and linearized with Kpn2I. Then, the linearized pGKG1G2 plasmid was electrotransformed into the host strain GS115(his4). The solution after electroporation was spread on the MD plate without histidine, and cultured at 30°C until the transformant grew out. Among them, since GS115 (his4) is a histidine-deficient strain, it cannot grow on the MD plate without histidine, so the transformants grown on the plate are all Pichia pastoris transformed with the pGKG1G2 plasmid.

[0075] A number of transformants were picked at random, fermented and cultivated in shake flasks, and two Pichia pastoris strains with higher yields were selected, one of which was named HZ109, and the other was named HZ117. Among them, HZ109 was submitted to China Center for Type Culture Collection (CCTCC) for preservation o...

Embodiment 3

[0084] Example 3 , HZ109 and HZ117 shake flask fermentation to produce glutathione

[0085] A single colony of HZ109, HZ117 and HZ100 (as a control) grown on a YPD plate for three days at 30°C was inserted into 5mL of YPD medium respectively, and cultured overnight at 30°C and 200rpm.

[0086] Transfer 0.25mL of bacterial liquid into 25mL of BMGY medium, culture at 30°C, 200rpm for 96h, add glycerol to 1% at 24h, 48h, and 72h, and add precursor L-cysteine ​​to 0.01mol / L , and samples were taken at 48h, 72h, and 96h of fermentation to detect the GSH output in the culture medium, and the detection results are shown in Table 1.

[0087] Table 1. GSH production in HZ109, HZ117 and HZ100 in different time periods

[0088]

[0089] According to the results in Table 1, the yields of GSH in HZ109 and HZ117 are about twice the yield of GSH in the control HZ100, and the yields are basically similar. Therefore, in the next example, only HZ109, which has a relatively higher yield in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a glutathione synthetase-system recombinant plasmid as well as a construction method and application thereof, a recombinant strain for expressing glutathione synthetase systems as well as a construction method and application thereof, and a method for producing glutathione. The glutathione synthetase-system recombinant plasmid comprises a GSH1 sequence, a GSH1 sequence and a suitable vector fragment. The recombinant strain for glutathione synthetase systems is constructed by use of the glutathione synthetase-system recombinant plasmid. The method for producing glutathione comprises the step of fermenting the recombinant strain for glutathione synthetase systems. Glutathione-producing Pichia pastoris can be constructed by use of the coexpression plasmid provided by the invention; the obtained glutathione-producing Pichia pastoris is fermented and cultured; and the yield of glutathione in obtained fermentation broth is significantly higher than the current reported highest level of glutathione fermentation production. The invention has the advantages of improving the utilization rate of raw materials and reducing production cost and energy consumption, and can be used for industrial production.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for producing glutathione with metabolic engineering bacteria. Background technique [0002] Glutathione, namely γ-L-glutamyl-L-cysteinyl-glycine, referred to as GSH, is composed of precursor substances L-glutamic acid, L-cysteine ​​and glycine through γ-glutamyl Cysteine ​​synthase (GSH1) and glutathione synthase (GSH2) catalyze the synthesis, which can effectively remove free radicals in the human body, purify the environmental pollution in the human body, and improve human health. GSH has a wide range of uses in the fields of medicine, food and cosmetics. [0003] The industrial production of glutathione mainly includes extraction method, chemical synthesis method, fermentation method and enzymatic method. The early production of glutathione used the extraction method, and the raw material was mostly yeast. This is a classic method for the product...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/52C12N1/19C12P21/02C12R1/84
Inventor 杨晟杨俊杰陶荣盛曹传增范文超
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI