Recombinant fusion proteins containing p53 genes, recombinant and application thereof

A technology of p53 gene and fusion protein, applied in medical preparations containing active ingredients, drug combinations, peptide/protein components, etc., can solve the problems of tumor cells being invasive and prone to distant metastasis

Inactive Publication Date: 2010-03-31
INST OF PHARMACOLOGY & TOXICOLOGY ACAD OF MILITARY MEDICAL SCI P L A
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Many clinical evidences have shown that tumor cells undergo a series of adaptive changes in a hypoxic environment, making tumor cells resistant to radiotherapy and chemotherapy, and making tumor cells more invasive and prone to distant metastasis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant fusion proteins containing p53 genes, recombinant and application thereof
  • Recombinant fusion proteins containing p53 genes, recombinant and application thereof
  • Recombinant fusion proteins containing p53 genes, recombinant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0068] Example 1, preparation of p53 gene

[0069] Take 1g of human fetal total RNA, and add the reaction components sequentially according to the operation guide of cDNA synthesis system. The total reaction volume is 20 μl, reacted at 42°C for 15 minutes, then inactivated at 95°C for 5 minutes, and used as a PCR template. Using P7: GAGAATTCATGGAGGAGCCGCAGTC; P4: CCGTCGACTTAGTCTGAGTCAGGC as primers, PCR human full-length p53 gene.

[0070] Take the PCR fragments of vector pET28a and p53 respectively, carry out double digestion with EcoR I and SalI, treat at 37°C for 3h, and then recover with gel recovery kit. The pET carrier fragment and p53 fragment were mixed at a ratio of 1:3, added with 3 U of T4 ligase, reacted at 16°C for 16 hours, and transformed the reaction product into competent Escherichia coli DH5α, picked the successfully transformed colony, and extracted the plasmid for PCR identification. The positive clone was named pET-p53 after correct sequencing. The pE...

example 2

[0071] Example 2, preparation of GnRH-ODD-p53 gene and GnRHIII-ODD-p53 gene

[0072]GnRH and GnRHIII genes were constructed by overlap extension method. Equal amounts of GP1: CTAGCATGGAGCACTGGTCCTATGGACTGCGCCCTGGAA and GP2: AGCTTTCCAGGGCGCAGTCCATAGGACCAGTGCTCCATG were mixed into the PCR reaction system and reacted 30 times to obtain the fragment (GnRH).

[0073] In the same way, G3P1:

[0074] CTAGCATGGAGCACTGGTCCCACGACTGGAAGCCTGGAA and G3P2:

[0075] An equal amount of AGCTTTCCAGGCTTCCAGTCGTGGGACCAGTGCTCCATG was mixed and added into the PCR reaction system, and reacted 30 times to obtain the fragment (GnRHIII).

[0076] Mix the pET-p53 vector digested with Nhe I and HindIII with GnRH or GnRHIII fragments at a ratio of 1:3, add T4 ligase, react at 16°C for 16 hours, transform the reaction product into competent Escherichia coli DH5a, pick Successfully transformed colonies were identified by plasmid PCR. The positive clones were correctly named pET-GnRH-p53(GP) and pET-Gn...

example 3

[0078] Example 3, preparation of GnRH-ODD-p53 and GnRHIII-ODD-p53 fusion protein

[0079] 1), expression of GnRH-ODD-p53 and GnRHIII-ODD-p53

[0080] Pick the positive colonies transformed into pET-GnRH-p53 and pET-GnRHIII-p53 respectively and place them in LB medium (containing kanamycin 60g / ml) for activation, then inoculate them in 2YT medium according to 5-20%, and cultivate until OD 600 When the value is 0.5-2.0, add IPTG to 0.4-1mM to induce expression. Collect the bacterial cells induced to express for 3-24 hours, and wash with PBS.

[0081] 2), Western blot identification of GnRH-ODD-p53 and GnRHIII-ODD-p53

[0082] The fusion protein obtained by induced expression was subjected to polyacrylamide gel electrophoresis (12% SDS-PAGE, see image 3 ) analysis showed that there was target protein in the precipitate, and its molecular weight was consistent with the theoretical value. After western blotting, it was identified and analyzed as GnRH-p53 series fusion p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fusion gene which comprises a GnRH gene sequence, a p53 gene sequence and an optional gene sequence of an oxygen-dependent protein degradation structural domain (ODD) of a hypoxia-inducible factor between the GnRH gene sequence and the p53 gene sequence. The invention also relates to recombinant fusion proteins, an expression recombinant of the fusion genes, engineeringbacteria obtained from the expression recombinant and pharmaceutical applications of the expression recombinant and the fusion proteins. A function of resisting tumor of p53 can be efficiently improved according to the invention.

Description

technical field [0001] The present invention relates to GnRH-p53 series fusion proteins and their anti-tumor applications, in particular to recombinant fusion proteins containing p53 gene and recombinants and their applications, more specifically, the present invention relates to the expression of human tumor suppressor gene p53 and A fusion protein of a gonadotropin-releasing hormone and an oxygen-dependent protein degradation domain and the use of the fusion protein in preparing antitumor drugs. Background technique [0002] Cancer is still a serious threat to human health, with high morbidity and mortality, especially adenocarcinoma, which is one of the most difficult malignant tumors to treat clinically. Although the technologies and means of early diagnosis of malignant tumors, surgery, radiotherapy and chemotherapy have made great progress and development in recent years, surgical treatment is limited to early treatment, and the severe side effects of chemotherapy and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/62C12N15/63C12N1/21C07K19/00A61K38/17A61P35/00C12R1/19
Inventor贾培媛王玉霞赵宇武军华
OwnerINST OF PHARMACOLOGY & TOXICOLOGY ACAD OF MILITARY MEDICAL SCI P L A