Fluorescent biosensing method for detection of interaction between small organic molecules and binding proteins based on restriction endonuclease foki inhibition assay

A technology of restriction endonuclease and binding protein, which is applied in the field of fluorescent biosensing based on restriction enzyme FokI inhibition analysis to detect the interaction between organic small molecules and binding protein, which can solve the problem of poor reliability and low sensitivity of detection technology , can not meet the problems of accurate and fast detection, and achieve the effect of simple design and fast and easy operation

Inactive Publication Date: 2012-02-15
HUNAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These detection techniques have low sensitivity, poor reliability, and require sophisticated instruments, which cannot meet the needs of accurate and rapid detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Detection of biotin based on restriction endonuclease FokI inhibition assay

[0025] 1) Cross-linking of intermediate amino-labeled oligonucleotide DNA strands and biotin

[0026] Weigh 6.1 mg of biotin and dissolve it in 2.5 mL of phosphate buffer solution (0.1 M NaH 2 PO4, pH 7.4), then add 1 mg of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), stir at room temperature for 15 min, then add 2.8 mg

[0027] N-hydroxysuccinimide (NHS) was reacted at room temperature for 30 min. 260 μl of activated biotin solution was added to 260 μl of 10 μM concentration of intermediate amino-labeled oligonucleotide DNA single strand (GAACAACAACCAACATCCAAACTTCTATATATGGATGAAT(NH2)CAAC) solution, and reacted at room temperature for 2 h under slight stirring. After the reaction, 3.6 mg of hydroxylamine hydrochloride was added to the mixture to terminate the reaction.

[0028] The cross-linking reaction product was transferred to a 1 mL dialysis tube with a molecular we...

Embodiment 2

[0031] Example 2: Detection of folate-binding proteins based on restriction endonuclease inhibition assays

[0032] 1) Cross-linking of oligonucleotide DNA single strands labeled with intermediate amino groups and folic acid

[0033]Weigh 10mg of folic acid and dissolve in 2.5mL phosphate buffer solution (0.1M NaH 2 PO4, pH 7.4), then add 1mg of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), stir at room temperature for 15min, then add 2.8mg of N-hydroxysuccinate Imide (NHS), react at room temperature for 30min. Take 260 μl of the activated folic acid solution and add it to 260 μl of 10 μM intermediate amino-labeled oligonucleotide DNA single strand (GAACAACAACCAACATCCAAACTTCTATATGGATGAAT(NH2)CAAC) solution, and react at room temperature for 2 hours under gentle stirring. After the reaction, 3.6 mg of hydroxylamine hydrochloride was added to the mixed solution to terminate the reaction.

[0034] Transfer the cross-linked reaction product to a 1 mL dialysis tube with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention is a fluorescent biosensing method for detecting the interaction between organic small molecules and binding proteins based on restriction endonuclease inhibition analysis, including the interaction between the oligonucleotide DNA chain modified by the intermediate organic small molecules and the protein, restriction Conditions for the formation of endonuclease FokI dimers, selection of inhibitory sites, and real-time fluorescent quantitative detection technology based on Taqman probes. It utilizes the specific combination of small organic molecules modified in the middle of the oligonucleotide DNA chain and its binding protein or antibody, based on the inhibition of restriction endonuclease FokI digestion by the interaction between small organic molecules and proteins or antibodies, through the The cleaved Taqman probe is used for quantitative real-time fluorescence analysis to detect the interaction between small organic molecules and proteins and the small organic molecules or their binding proteins. The method has high sensitivity, simple operation and strong specificity, and can be used in the study of signal transduction and molecular regulation mechanism in biomedicine, food and agricultural product safety detection, environmental toxicant detection, drug screening, etc.

Description

technical field [0001] The invention belongs to a biosensing technology for detecting the interaction between small organic molecules and binding proteins. Interaction between nucleotide DNA chain and protein, restriction endonuclease FokI inhibition analysis, and real-time fluorescent quantitative detection method based on Taqman probe. Background technique [0002] The rapid screening and detection of organic small molecules such as organic small molecules and binding proteins, drugs and chemical toxins, and small molecule binding proteins is extremely important for clinical diagnosis, medical research, food and public safety, drug screening, environmental monitoring and other fields. meaning. At present, the commonly used detection techniques for the interaction between small organic molecules and binding proteins mainly include surface plasmon resonance, enzyme complementary fragment immunoassay, and fluorescence anisotropy analysis. These detection techniques have low...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/44G01N21/64
Inventor 蒋健晖甄珍楚霞沈国励俞汝勤
Owner HUNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap