Gram positive microbes DNA vaccine and construction and application thereof
A Gram-positive bacteria, DNA vaccine technology, applied in the field of molecular biology and immunology, can solve the problem of less DNA vaccine and achieve the effect of high protection rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0018] The DNA vaccine is shown by the base sequence in the sequence table SEQ ID No.1.
[0019] Sequence Listing 1
[0020] ATGAAAAAAATCGCAACTATTACTACATTAACAGCAGGCATTGGCGCTGCATATTTCGGTACAACTGCTCATCACGCAGA
[0021] TGCTGCAGAATTTAATCAATCAAATAATCAATCATATAATTATAATACAGCTCAAACATCTACTAGCAATACTACATCAG
[0022] AAAGATCTGCTTCTGGTAACTTATATACAGCTGGTCAATGTACTTGGTACGTTTATGACAAAGTTGGCGGAAAAGTAGGC
[0023] TCAACTTGGGGAGACGCTAGAAACTGGGCATCAGCTGCACAACAAGCTGGTTATACAGTCAAATCATACACCAAAAAGCTGG
[0024] ATCAATTTTACAATCATCAGCAGGTGGTTATGGTCACGTTGCTTATGTTGAAAGTGTTGGTTCTGACGGTTCAGTTACAG
[0025] TTTCTGAAATGAACTATAGCGGTGGACCTTTCTCAGTAAGCACACGTACTATTTCTGCAGGTGAAGCAAGCTCATATAAT
[0026] TATATTCATATCTAA
[0027] (a) Sequence features:
[0028] ●Length: 495bp
[0029] ●Type: base sequence
[0030] ●Chain type: single chain
[0031] ●Topological structure: linear
[0032] (b) Molecular type: double-stranded DNA
[0033] (c) Assumption: No
[0034] (d) Antisense: no
[0035] (e) Original source: ...
Embodiment 2
[0038] The construction method of Streptococcus iniae DNA vaccine:
[0039] Streptococcus iniae G26 was used as a template and F4 / R2 was used as primers for PCR amplification. The PCR conditions were: 94°C for 60s to pre-denature the template DNA, then 94°C for 40s, 47°C for 60s, 72°C for 60s, after 5 cycles, change to 94°C for 40s, 65°C for 60s, 72°C for 60s, 25 cycles, and then extended reaction at 72°C for 10min. After the PCR product was purified with the Tiangen DNA Product Purification Kit, it was ligated with the PCR cloning vector pBS-T (purchased from "Tiangen Biochemical Technology Co., Ltd.", Beijing) at room temperature for 2-4 hours, and the ligation mixture was transformed into Escherichia coli DH5α After containing 100ug / ml Anka penicillin (Ap), 40ug / ml 5-bromo-4-chloro-3-indole-β-D-lactoside (Xgal) and 24ug / ml isopropyl-β-D- The thiogalactoside (IPTG) LB solid medium was cultured for 18 hours, the white transformant was picked out, and the plasmid was extracte...
Embodiment 3
[0043] Application of Streptococcus iniae DNA Vaccine
[0044] Step 1) Preparation of vaccine preparation liquid. Suspend the plasmid pCNS10 obtained above in PBS to a final concentration of 200ug / ml, which is the DNA vaccine preparation solution.
[0045] The composition of PBS is by weight percentage: 0.8% NaCl, 0.02% KCl, 0.358% Na 2 HPO 4 .12H 2 O, 0.024% NaH2 PO 4 .
[0046] Step 2) Immunization injection of the vaccine. 50 flounder (each weighing about 9g) were randomly divided into 2 groups (25 fish / group), named A and B respectively. Each fish in group A (immunization group) was injected intramuscularly with 100ul of the DNA vaccine preparation solution in step 1) above, and each fish in group B (control group) was injected intramuscularly with 100ul PBS.
[0047] Step 3) Preparation of Streptococcus iniae suspension. Grow S. iniae G26 to OD in LB medium 600 0.7, then centrifuged at 5000g, 4°C for 10min. Collect the cells and suspend them in PBS to a final co...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 