Unlock instant, AI-driven research and patent intelligence for your innovation.

Gram positive microbes DNA vaccine and construction and application thereof

A Gram-positive bacteria, DNA vaccine technology, applied in the field of molecular biology and immunology, can solve the problem of less DNA vaccine and achieve the effect of high protection rate

Inactive Publication Date: 2010-09-22
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are currently few DNA vaccines against bacteria in aquaculture

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] The DNA vaccine is shown by the base sequence in the sequence table SEQ ID No.1.

[0019] Sequence Listing 1

[0020] ATGAAAAAAATCGCAACTATTACTACATTAACAGCAGGCATTGGCGCTGCATATTTCGGTACAACTGCTCATCACGCAGA

[0021] TGCTGCAGAATTTAATCAATCAAATAATCAATCATATAATTATAATACAGCTCAAACATCTACTAGCAATACTACATCAG

[0022] AAAGATCTGCTTCTGGTAACTTATATACAGCTGGTCAATGTACTTGGTACGTTTATGACAAAGTTGGCGGAAAAGTAGGC

[0023] TCAACTTGGGGAGACGCTAGAAACTGGGCATCAGCTGCACAACAAGCTGGTTATACAGTCAAATCATACACCAAAAAGCTGG

[0024] ATCAATTTTACAATCATCAGCAGGTGGTTATGGTCACGTTGCTTATGTTGAAAGTGTTGGTTCTGACGGTTCAGTTACAG

[0025] TTTCTGAAATGAACTATAGCGGTGGACCTTTCTCAGTAAGCACACGTACTATTTCTGCAGGTGAAGCAAGCTCATATAAT

[0026] TATATTCATATCTAA

[0027] (a) Sequence features:

[0028] ●Length: 495bp

[0029] ●Type: base sequence

[0030] ●Chain type: single chain

[0031] ●Topological structure: linear

[0032] (b) Molecular type: double-stranded DNA

[0033] (c) Assumption: No

[0034] (d) Antisense: no

[0035] (e) Original source: ...

Embodiment 2

[0038] The construction method of Streptococcus iniae DNA vaccine:

[0039] Streptococcus iniae G26 was used as a template and F4 / R2 was used as primers for PCR amplification. The PCR conditions were: 94°C for 60s to pre-denature the template DNA, then 94°C for 40s, 47°C for 60s, 72°C for 60s, after 5 cycles, change to 94°C for 40s, 65°C for 60s, 72°C for 60s, 25 cycles, and then extended reaction at 72°C for 10min. After the PCR product was purified with the Tiangen DNA Product Purification Kit, it was ligated with the PCR cloning vector pBS-T (purchased from "Tiangen Biochemical Technology Co., Ltd.", Beijing) at room temperature for 2-4 hours, and the ligation mixture was transformed into Escherichia coli DH5α After containing 100ug / ml Anka penicillin (Ap), 40ug / ml 5-bromo-4-chloro-3-indole-β-D-lactoside (Xgal) and 24ug / ml isopropyl-β-D- The thiogalactoside (IPTG) LB solid medium was cultured for 18 hours, the white transformant was picked out, and the plasmid was extracte...

Embodiment 3

[0043] Application of Streptococcus iniae DNA Vaccine

[0044] Step 1) Preparation of vaccine preparation liquid. Suspend the plasmid pCNS10 obtained above in PBS to a final concentration of 200ug / ml, which is the DNA vaccine preparation solution.

[0045] The composition of PBS is by weight percentage: 0.8% NaCl, 0.02% KCl, 0.358% Na 2 HPO 4 .12H 2 O, 0.024% NaH2 PO 4 .

[0046] Step 2) Immunization injection of the vaccine. 50 flounder (each weighing about 9g) were randomly divided into 2 groups (25 fish / group), named A and B respectively. Each fish in group A (immunization group) was injected intramuscularly with 100ul of the DNA vaccine preparation solution in step 1) above, and each fish in group B (control group) was injected intramuscularly with 100ul PBS.

[0047] Step 3) Preparation of Streptococcus iniae suspension. Grow S. iniae G26 to OD in LB medium 600 0.7, then centrifuged at 5000g, 4°C for 10min. Collect the cells and suspend them in PBS to a final co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the molecular biology and immunology field, in particular to a gram positive microbes DNA vaccine and construction and application thereof. The vaccine has base sequence in sequence table SEQ ID No.1. The preparation method is that an eukaryotic expression vector pCN3 is used to construct streptococcus iniae DNA vaccine plasmid pCNS 10 which is suspended in PBS to be the DNA vaccine. The DNA vaccine has vaccine protection effect for streptococcus iniae and is the first construction in the whole world. The application is simple and once vaccine can achieve high efficiency and long-term vaccine protection effect.

Description

technical field [0001] The invention relates to the fields of molecular biology and immunology, in particular to a Gram-positive bacteria DNA vaccine and its construction and application. Background technique [0002] Streptococcus iniae is a gram-positive bacterium that can infect humans, animals and a variety of fish, including tilapia, red sea bream, flounder, perch, rainbow trout, turbot, grouper, etc. . Streptococcus iniae has been recognized as an important aquaculture pathogen, which causes huge economic losses to the aquaculture industry in my country and the world every year. Currently, the commercial S. iniae vaccine is only a simple inactivated vaccine, and the use of this vaccine in Israel has proved to have various disadvantages, including short protective effect and regionality. Different from simple inactivated vaccines, DNA vaccines are molecular vaccines whose construction principle is to clone the vaccine antigen gene into a eukaryotic expression vector, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61K39/09A61P31/04C12N15/31C12N15/74
Inventor 孙黎孙云
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More