Construction and application of IRES (Internal Ribosome Entry Site) mediated four GH (Growth Hormone) subtypes and IGF-I (Insulin-like Growth Factor-I) bicistronic eukaryon co-expression vector

A technology for IGF-I and co-expression vectors, applied in the field of construction of bicistronic eukaryotic co-expression vectors

Inactive Publication Date: 2010-11-24
UNIV OF SCI & TECH BEIJING
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, GH mainly has four subtypes of 22kD, 20kD, 17kD, and 5kD in the human body. The interaction between GH and IGF-I is mainly based on the research of GH subtype 22kD, and the other three subtypes are less studied.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of IRES (Internal Ribosome Entry Site) mediated four GH (Growth Hormone) subtypes and IGF-I (Insulin-like Growth Factor-I) bicistronic eukaryon co-expression vector
  • Construction and application of IRES (Internal Ribosome Entry Site) mediated four GH (Growth Hormone) subtypes and IGF-I (Insulin-like Growth Factor-I) bicistronic eukaryon co-expression vector
  • Construction and application of IRES (Internal Ribosome Entry Site) mediated four GH (Growth Hormone) subtypes and IGF-I (Insulin-like Growth Factor-I) bicistronic eukaryon co-expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] 1. Cloning of the four subtypes of GH and IGF-I target DNA

[0031] According to the comparison of GH mRNA sequence and protein sequence published by Genebank, the coding sequence of the four subtypes of GH is obtained: 22kD coding sequence is sequence 1, 20kD coding sequence is sequence 2, 17kD coding sequence is sequence 3, 5kD coding sequence The sequence is sequence 4. Design GH primers, and add XhO I and EcoR I restriction enzyme sites at the 5'ends of the upstream and downstream primers, add atg start codon, and 22kD primers (upstream: 5-ccgctcgagatgttcccaaccattcccttatc-3 ; Downstream: 5-cggaattcttatcagaagccacagctgccctc-3); 20kD primer (upstream: 5-ccgctcgagatgttcccaaccattcccttatc-3; downstream: 5-cggaattcttatcagaagtagtccacagctgccctc-3); 17kD primer (upstream: cagactcagtcccctgagctag5-cctcagtcccctgacctag-3); 5kD primer (5-ccgctcgagatgttcccaaccattcccttatc-3, downstream: 5-cggaattcttatcatgaatacttctgttcctttgg-3);

[0032] According to the comparison of the mRNA sequence ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to construction and application of an IRES (Internal Ribosome Entry Site) mediated four GH (Growth Hormone) subtypes and IGF-I (Insulin-like Growth Factor I) bicistronic eukaryon co-expression vector. The construction comprises the following steps of: obtaining coding sequence design primers of four GH subtypes and the IGF-I by the comparison of the mRNA sequence and the protein sequence of the GH and the IGF-I; obtaining a target DNA of the four GH subtypes and the IGF-I through a PCR (Polymerase Chain Reaction) method by taking the DNA of the GH and the IGF-I in a laboratory as a template; connecting a PCR product to a pBS-T vector to obtain TA vectors of the GH and the IGF-I; carrying out XhO I and EcoR I double enzyme digestion on the TA vector and directionally inserting genes of the four GH subtypes into the pCI-IRES to successfully construct recombinant plasmids of the four GH subtypes: pCI-22-IRES, pCI-20-IRES, pCI-17-IRES and pCI-5-IRES; and carrying out Sam I and Not I double enzyme digestion on the TA vector of the IGF-I and respectively and directionally inserting genes of the IGF-I into such recombinant plasmids to successfully construct the IRES mediated four human GH subtypes and IGF-I bicistronic eukaryon co-expression vector: pCI-22-IRES-IGF-I, pCI-20-IRES-IGF-I, pCI-17-IRES-IGF-I and pCI-5-IRES-IGF-I. The invention provides convenient and efficient basic data for further studying biological characteristics and functions of the four GH subtypes and the IGF-I gene.

Description

Technical field [0001] The invention relates to the field of biomedicine. In particular, it relates to the construction method and application of the four subtypes (22kD, 20kD, 17kD, 5kD) of human growth hormone (GH) mediated by IRES and the bicistronic eukaryotic co-expression vector of IGF-I. Background technique [0002] Human Growth Hormone (GH) is the most important endocrine hormone secreted by the pituitary gland. GH has many beneficial effects on metabolism and lipolysis, such as increasing cardiac output and lipolysis during exercise, improving the thermal stability of the internal environment, providing energy to enhance endurance exercise, and possibly increasing ligament strength and wound healing rate, and Can promote protein synthesis and bone growth. GH binds to the GH receptor through the circulatory system to stimulate the liver to produce insulin-like growth factor I (IGF-I), which is its most important factor. IGF-I is a polypeptide that not only promotes ce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85C12N15/66C12N15/18C12N15/12A61K48/00A61P5/00
Inventor杜宏武李传宝金海明华甜
OwnerUNIV OF SCI & TECH BEIJING