Construction and application of IRES (Internal Ribosome Entry Site) mediated four GH (Growth Hormone) subtypes and IGF-I (Insulin-like Growth Factor-I) bicistronic eukaryon co-expression vector
A technology for IGF-I and co-expression vectors, applied in the field of construction of bicistronic eukaryotic co-expression vectors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0030] 1. Cloning of the four subtypes of GH and IGF-I target DNA
[0031] According to the comparison of GH mRNA sequence and protein sequence published by Genebank, the coding sequence of the four subtypes of GH is obtained: 22kD coding sequence is sequence 1, 20kD coding sequence is sequence 2, 17kD coding sequence is sequence 3, 5kD coding sequence The sequence is sequence 4. Design GH primers, and add XhO I and EcoR I restriction enzyme sites at the 5'ends of the upstream and downstream primers, add atg start codon, and 22kD primers (upstream: 5-ccgctcgagatgttcccaaccattcccttatc-3 ; Downstream: 5-cggaattcttatcagaagccacagctgccctc-3); 20kD primer (upstream: 5-ccgctcgagatgttcccaaccattcccttatc-3; downstream: 5-cggaattcttatcagaagtagtccacagctgccctc-3); 17kD primer (upstream: cagactcagtcccctgagctag5-cctcagtcccctgacctag-3); 5kD primer (5-ccgctcgagatgttcccaaccattcccttatc-3, downstream: 5-cggaattcttatcatgaatacttctgttcctttgg-3);
[0032] According to the comparison of the mRNA sequence ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com