Fluorescent quantitative RT-PCR detection method of M.tuberculosis-complex

A technique for Mycobacterium tuberculosis and fluorescence quantification, which is applied in the determination/inspection of microorganisms, fluorescence/phosphorescence, biochemical equipment and methods, etc. Reliable source, avoid use, avoid contamination effect

Inactive Publication Date: 2011-02-16
FUDAN UNIV
View PDF2 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The main basis for clinical diagnosis of pulmonary tuberculosis is to detect Mycobacterium tuberculosis in sputum. Among them, the smear method is simple and easy, but the positive rate is low; although the Roche culture method is the gold standard, the detection cycle is long, and it is difficult to meet the clinical needs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative RT-PCR detection method of M.tuberculosis-complex
  • Fluorescent quantitative RT-PCR detection method of M.tuberculosis-complex
  • Fluorescent quantitative RT-PCR detection method of M.tuberculosis-complex

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Designing primers and Taqman probes

[0031] Experimental steps:

[0032] In the RDP (Ribosomal Database Project) ribosomal sequence analysis database, the complete 16srRNA sequence of the Mycobacterium tuberculosis complex was searched, and a conserved segment of the sequence was selected through bioinformatics comparison analysis, and a primer express software and primer premier 5.0 software were used to design a Reverse transcription primers, a pair of PCR primers and a Taqman probe. The fluorescent reporter group at the 5' end of the probe is FAM, and the fluorescent quencher group at the 3' end is TAMRA. The primers and probe are located in the Mycobacterium tuberculosis complex Group 16srRNA region, the target amplification fragment is 100 bp.

[0033] The primer and probe sequences are:

[0034] Reverse transcription primer: CCGTATCTCAGTCCCAGTGT

[0035] Upstream primer: MTBC-F: GGGATGCATGTCTTGTGGTG

[0036] Downstream primer: MTBC-R: CCGTCGTCGCCTTGG...

Embodiment 2

[0038] Example 2: Construction and preparation of quantitative standards

[0039] Implementation steps

[0040] 1. Construction of quantitative standards

[0041] The Mycobacterium tuberculosis complex (MTBC) gene fragment containing the target sequence was cloned by RT-PCR, recombined into the plasmid vector pGEM-T Easy, and the DNA sequence was determined. The constructed recombinant plasmid was used as a quantitative standard for detecting the Mycobacterium tuberculosis complex and was named pGEM-T Easy-16srRNA.

[0042] 2. Preparation of Quantitative Standards

[0043] After the plasmid pGEM-T Easy-16srRNA was extracted and purified, the concentration of the plasmid was calculated according to the OD260, OD280 and OD230 values ​​measured by the ultraviolet spectrophotometer, the purity of the plasmid was detected, and the copy number was converted according to the Avogadro constant.

[0044] Calculated as follows:

[0045] Plasmid concentration (ug / ul) = OD260 X diluti...

Embodiment 3

[0050] Example 3: Isolation and extraction of bacteria in sputum samples

[0051] 1. Pretreatment of Sputum Samples

[0052] (1) Take the morning sputum and place it in a sterile sealed bottle, and treat it with NaOH.

[0053] (2) Add an equal volume of 10% NaOH solution, vortex and oscillate to mix well, and put it in a 37°C water bath for digestion for more than 30 minutes until the sputum is completely digested;

[0054] (3) Mix the phlegm and digestive fluid, take 1 ml of the liquefied phlegm sample, centrifuge at 12000 rpm for 5 min in a clean 1.5ml EP tube, and remove the supernatant;

[0055] (4) Wash the precipitate from the previous step with 1ml of cleaning solution (10mM EDTA or normal saline), vortex and mix well, centrifuge at 12000 rpm for 5min, remove the supernatant and keep the precipitate for inspection.

[0056] 2. Simultaneous extraction of RNA and DNA in bacteria using a new extraction method

[0057] (1) Bacterial lysis: Resuspend the precipitate obtai...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological engineering detection, in particular relates to a fluorescent quantitative RT-PCR detection method of M.tuberculosis-complex. The invention includes the following steps: M.tuberculosis-complex specificity quantitative RT-PCR primer and probe are designed; standard molecule is constructed; coextraction of bacterium samples RNA and DNA is carried out; RT-PCR and PCR are respectively carried out on the same sample; and a fluorescent quantitative PCR detection method is created and optimized. By applying the method of the invention to detect M.tuberculosis-complex, the advantages of fast speed, high sensitivity and strong specificity can be achieved, dead bacterium and living bacterium can be distinguished, and the defects that detection period is long, positive rate is low and distinguishing of dead bacterium and living bacterium can not be realized in the existing detection method can be overcome, thus having important practical application value.

Description

technical field [0001] The invention belongs to the technical field of bioengineering detection, in particular to a fluorescence quantitative detection method for mycobacterium tuberculosis complex in clinical samples. Background technique [0002] The Mycobacterium tuberculosis complex includes Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, and Mycobacterium microti. Mycobacterium tuberculosis is the main pathogen that causes human tuberculosis. In addition, Mycobacterium bovis not only causes bovine tuberculosis, but also a small number of human tuberculosis. Mycobacterium africanum is weakly pathogenic and is the causative agent of tuberculosis in tropical Africans. Mycobacterium microti is not pathogenic to humans. [0003] Tuberculosis is one of the public health problems that seriously endanger the world. Since the 1990s, tuberculosis has "resurrected" around the world. Many countries, including countries with better tuberculosis epidemic c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11C12Q1/06G01N21/64
Inventor姜丽娟李瑶吴伟
OwnerFUDAN UNIV