Fluorescent reverse transcription-polymerase chain reaction (RT-PCR) kit for quantitatively detecting leukemia fusion gene TEL-AML1
A technology of fusion gene and quantitative detection, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., to achieve the effects of high sensitivity, reduced pollution, and accurate quantification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Embodiment 1: the preparation of kit
[0043] 1. Primer and probe design and synthesis
[0044] Use Primer Express 2.0 to design and screen probes in the conserved regions in the non-fusion region of the AML1 gene and the fusion region of the TEL and AML1 genes, and design upstream and downstream primers for the AML1 gene and the TEL-AML1 fusion gene on the basis of the selected probes . Both primers and probes were synthesized by a professional company (Shenggong), wherein the primers were purified by PAGE, and the probes were purified by HPLC. The 5' end of the probe was labeled with a FAM fluorescent group, and the 3' end was labeled with a TAMRA fluorescent group.
[0045] The amplified sequence is shown in Table 1:
[0046] Table 1. Specific probe and primer sequences
[0047] sequence name
Oligonucleotide sequence (5'-3')
Base length (bp)
AML1 probe
TCAGCCTCACCCCTCTAGCCCTAC
24
TEL-AML1 probe
AGCAGAATGCATACTTGGAATGAAT...
Embodiment 2
[0062] Embodiment 2: the use of kit
[0063] 1. Sample extraction
[0064] Use RNA extraction solution to extract total RNA from the blood of the sample to be tested
[0065] Steps:
[0066] 1) Take a 0.5ml centrifuge tube, add 150μL of RNA extraction solution, then add 100μL of the sample to be tested (EDTA anticoagulant), and mix well.
[0067] 2) Add 50 μL of chloroform, centrifuge at 13000 rpm for 15 min at 4°C.
[0068] 3) Put the centrifuged upper layer into a new centrifuge tube, add 100 μL of isopropanol, and let stand at room temperature for 10 minutes.
[0069] 4) 4°C, 13000rpm, centrifuge for 15min.
[0070] 5) Gently pour off the supernatant, place it on absorbent paper, add 300 μL, ice-precooled 75% ethanol, centrifuge at 13000 rpm at 4 °C for 10 min.
[0071] 6) Gently pour off the supernatant, place it on absorbent paper, centrifuge briefly, carefully discard the supernatant with a pipette tip, and dry at room temperature for 1-5 minutes.
[0072] 7) Add ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
