Supercharge Your Innovation With Domain-Expert AI Agents!

Internal reference-containing kit for quantificationally detecting HCV with fluorescence RT-PCR technology

A detection kit and fluorescent quantitative technology, applied in the field of molecular biology, can solve the problems of undetectable, low HCV RNA level, and slow down of HCV RNA content reduction, and achieve the effect of long time, high specificity, and easy operation

Inactive Publication Date: 2011-07-06
SHANGHAI XINGYAO MED TECH DEV CO LTD +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The detection of HCV RNA in peripheral blood is a reliable indicator of active HCV replication. HCV RNA can be detected in serum within 1-2wk of infection, and HCV RNA in serum will reach a peak before the natural recovery of infection, but HCV RAN will reach its peak or Occasionally, it may be undetectable for days or weeks before reappearance. In most infected persons with chronic transformation, the rate of decline in HCV RNA levels gradually slows down and finally stabilizes. HCV RNA levels are very low in patients with advanced liver disease. can't even detect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Internal reference-containing kit for quantificationally detecting HCV with fluorescence RT-PCR technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0026] According to the comparison and analysis of HCV-related sequences in GeneBank, primers and probes were designed and prepared:

[0027] Primer 1: 5`-AACCAACCCGCTCAATACC-3` (Seq No.1)

[0028] Primer 2: 5`-GCACTCGCAAGCACCCT-3` (Seq No.2)

[0029] Probe 1: 5`-CCGCGAGATCACTAGCCGAGTAGT-3` (Seq No.3)

[0030] Design internal reference probe sequence: Probe 2:

[0031] 5`-ATCTACCCCAACACGAATCGCTACC-3` (Seq No.4)

[0032] Design and prepare synthetic RNA sequences:

[0033] Internal reference positive model RNA:

[0034] 5-AACCAACCCGCUCAAUACCCGGAAAUUUGGGCGUGCCCAUCUACCCAACACGAAUCGCUAC

[0035] CGUUGGGUCGCGAAAGGCCUUGUGGUACUGCCUGAUAGGGUGCUUGCGAGUGC-3`(Seq No.5)

[0036]The artificially synthesized RNA sequence was dissolved in DEPC-treated water and diluted to 1E+6copies / ml, 1E+5copies / ml and 1E+4copies / ml, which were used as RNA standards 1-3 in turn.

[0037] Prepare One step RT-PCR reaction buffer (final concentration) according to the following formula: 50mM Tris-HCl (Ph...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an internal reference-containing kit and a method for quickly, conveniently and quantificationally detecting HCV virus RNA with the fluorescence RT-PCR technology. The invention designs a detection primer and a probe for HCV gene sequence conserved fragments, carries out qualitative and quantificational detection on the HCV virus RNA by using the improved one-step method RT-PCR real-time amplification technology, and has the advantages of simpleness for operation, good repeatability as well as higher specificity and sensitivity.

Description

technical field [0001] The invention relates to a method for quantitatively detecting hepatitis C virus (HCV) RNA with an internal reference and using fluorescent RT-PCR technology, belonging to the field of molecular biology. Background technique [0002] Hepatitis C virus is a single-stranded positive-sense RNA virus. In 1991, the International Committee for Nomenclature of Viruses (ICTV) classified it as a Hepatitis C virus of the family Flaviviridae. Its genome contains a large open read of approximately 9033 nucleotides. Coding frame (ORF), which can encode a polyprotein precursor of 3010-3033 amino acids, 1 / 4 of the N-terminal of the polyprotein is sequentially composed of core protein (C) and envelope protein (E1 and E2) and other structural proteins, and the rest are sequentially NS2 , NS3, NS4 and NS5 and other non-structural proteins, the membrane protein is distributed on the surface of the virus, the NS3 protein has the function of protease, and the NS5 protein i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68G01N21/64C12R1/93
Inventor 何剑军夏懿吴大治韩倩沈维祥
Owner SHANGHAI XINGYAO MED TECH DEV CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More