Internal reference-containing kit for quantificationally detecting HCV with fluorescence RT-PCR technology
A detection kit and fluorescent quantitative technology, applied in the field of molecular biology, can solve the problems of undetectable, low HCV RNA level, and slow down of HCV RNA content reduction, and achieve the effect of long time, high specificity, and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0026] According to the comparison and analysis of HCV-related sequences in GeneBank, primers and probes were designed and prepared:
[0027] Primer 1: 5`-AACCAACCCGCTCAATACC-3` (Seq No.1)
[0028] Primer 2: 5`-GCACTCGCAAGCACCCT-3` (Seq No.2)
[0029] Probe 1: 5`-CCGCGAGATCACTAGCCGAGTAGT-3` (Seq No.3)
[0030] Design internal reference probe sequence: Probe 2:
[0031] 5`-ATCTACCCCAACACGAATCGCTACC-3` (Seq No.4)
[0032] Design and prepare synthetic RNA sequences:
[0033] Internal reference positive model RNA:
[0034] 5-AACCAACCCGCUCAAUACCCGGAAAUUUGGGCGUGCCCAUCUACCCAACACGAAUCGCUAC
[0035] CGUUGGGUCGCGAAAGGCCUUGUGGUACUGCCUGAUAGGGUGCUUGCGAGUGC-3`(Seq No.5)
[0036]The artificially synthesized RNA sequence was dissolved in DEPC-treated water and diluted to 1E+6copies / ml, 1E+5copies / ml and 1E+4copies / ml, which were used as RNA standards 1-3 in turn.
[0037] Prepare One step RT-PCR reaction buffer (final concentration) according to the following formula: 50mM Tris-HCl (Ph...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
