Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

82results about How to "Convenient Quantitative Detection" patented technology

Micro fluid control chip and preparation method and application thereof

The invention belongs to the technical field of micro fluid control, particularly disclosing a micro fluid control chip and a preparation method and application thereof. One side of the chip is provided with a plurality of sample introduction holes, each sample introduction hole is communicated with a sample introduction runner; after meeting, each sample introduction runner is communicated with a main runner; the main runner is provided with a narrow runner; a micro-sphere of which the size is 0.5-1.5 mm is filled in front of the inlet of the narrow runner; the outlet of the main runner is communicated to a waste liquid tank arranged at the other side of the chip. The preparation method mainly comprises: firstly preparing a PDMS substrate; then, preparing a PDMS cover plate with an upper groove; sticking the substrate onto the cover plate to obtain a semi-finished product of the chip; carrying out modified treatment on each runner in the semi-finished product of the chip; finally, putting the micro-sphere in, controlling the charge quantity, and finishing production. The micro fluid control chip of the invention has high solution mixing efficiency, stable solution flow rate, small volume, convenient carrying and relatively simple manufacturing; when being used for detecting the density of triphosadenine, the micro fluid control chip has the advantages of high sensitivity, favourable detection effect and the like and can not be affected by environment humidity.
Owner:HUNAN UNIV

Residue soil improvement experimental device for shield method tunnel construction

The invention discloses a residue soil improvement experimental device for shield method tunnel construction, belonging to the technical field of shield method tunnel construction. The experimental device comprises a steel cylinder, stirring blades, a stirring shaft, a motor, a speed reducer, a torque meter, a test block fixing device, a test block and the like, and is partitioned into a test cylinder and a stirring device, wherein four improvement solution injection ports are formed; the stirring blades are uniformly distributed on the wall of the steel cylinder; four stirring blades are crossly connected to the stirring shaft; the tail end of one of the stirring blades is provided with a tool material test block fixing device; the test block is fixed at the tail end of the stirring blade of the test block fixing device; the left lower parts of a connector pipe and a connector pipe valve are connected with the steel cylinder; and the right lower part of a drain pipe valve is connected with the steel cylinder. In the device, the flow plasticity and shearing resistance of residue soil are quantitatively described by measuring the rotary torques of the stirring blades, the permeability coefficient of residue soil is measured by performing a permeation experiment, and the abrasiveness of residue soil on a tool is detected by measuring the abrasion loss of a tool material.
Owner:SHENYANG HEAVY MACHINERY GROUP

Ratiometric fluorescent probe and application thereof in visual detection of glutathione

ActiveCN111269715AExpanding the Range of Fluorescent Color ChangesSolve the problem of instability of monochromatic fluorescence intensityMaterial nanotechnologyFluorescence/phosphorescenceFluoProbesUltraviolet
The invention discloses a ratiometric fluorescent probe and application thereof in visual detection of glutathione. The ratiometric fluorescent probe is a synthetic system constructed on the basis ofblue carbon dots and orange gold nanocluster dual-channel fluorescence signals. A fluorescence quenching system constructed by combining the ratiometric probe with copper ions can be used for fluorescence enhancement detection of glutathione; wherein a blue fluorescence signal of the ratiometric probe serves as an internal standard and keeps stable, quenched orange fluorescence can be recovered byglutathione, and quantitative monitoring of glutathione is achieved by measuring the linear relation between the ratio of the orange fluorescence intensity to the blue fluorescence intensity and theglutathione concentration. According to the method disclosed by the invention, visual detection of glutathione can be achieved by utilizing only one handheld ultraviolet lamp, and the method has the characteristics of rapid reaction, high sensitivity, good selectivity, strong anti-interference capability, low detection limit and the like.
Owner:HEFEI INSTITUTES OF PHYSICAL SCIENCE - CHINESE ACAD OF SCI

Bioelectrochemical sensor for detecting nuclear factor-kappab, its preparation method and application

The invention relates to a novel bioelectrochemical sensor for detecting nuclear factor-kappaB (NF-κB), its preparation method and its application. The novel bioelectrochemical sensor is a three-electrode system sensor, which is characterized in that the counter electrode in the three electrodes is a platinum electrode, the reference electrode is a saturated calomel electrode, and the working electrode is a gold electrode, and the gold electrode is decorated with strand of DNA. The sensor can successfully identify the lowest concentration of NF-κB at 0.1nM, and the linear detection range is 0.1nM~10nM. The novel bioelectrochemical sensor of the present invention is based on the specific combination of NF-κB and target DNA, and comprehensively uses the dual signal amplification characteristics of Nicking Enzyme (NEase) and gold nanoparticles, as well as the high sensitivity of the electrochemical detection method, so that NF-κB The detection of κB is simple and feasible, and the same principle can also be extended to the detection of other biomolecules, with broad application prospects.
Owner:SHANGHAI UNIV

Stem-loop structured combined probe and application thereof

The invention discloses a stem-loop structured combined probe and application thereof. The probe is constituted by two DNA sequences of stem-loop structures; from 5' terminals to 3' terminals, probe I and probe II sequentially include stem-loop zones and detection object recognition zones, and are applicable to telomerase activity, RNA and DNA detection and telomerase inhibitor screening; when a detection object is telomerase, the detection object recognition zone of the probe I is a telomerase substrate sequence, and the detection object recognition zone of the probe II is a sequence which is complementary with 8-40 bases in a telomerase extension sequence; and when the detection object is RNA or DNA, the detection object recognition zone of the probe I is a sequence which is complementary with 8-40 bases, close to the 3' terminal, of to-be-detected RAN or DNA, and the detection object recognition zone of the probe II is a sequence which is equal to 8-40 bases, close to the 5' terminal, of the to-be-detected RAN or DNA. The combined probe disclosed by the invention is unnecessary to make use of fluorescence labeling and radioactive element labeling, and the combined probe, with the specific stem-loop structure, provides a specific amplification template for a nucleic acid amplification reaction, so that rapid signal amplification under constant temperature is achieved; and the combined probe is high in sensitivity and amplification efficiency.
Owner:SHAANXI NORMAL UNIV

Method for quantitatively detecting protein acetylation level

InactiveCN103048471AOvercome weak affinityOvercoming the disadvantages of being difficult to efficiently enrich acetylated proteinsBiological testingFluorescence/phosphorescenceProtein AcetylationAntibody affinity
The invention belongs to the technical field of biology, and particularly discloses a method for quantitatively detecting a protein acetylation level. The method particularly comprises the steps of preparing protein chips, drawing standard curves and detecting actual samples. The method overcomes the defects that antibodies have weak affinities and acetylated protein is difficult to enrich efficiently when acetylation antibodies are subjected to immune precipitation enriching directly; the protein acetylation level can be quantitatively detected quickly and simply; the used sample amount is less; the difference comparison among the different samples is facilitated; the study of an acetylation difference spectrogram provides a technology platform for establishing high-flux protein acetylation difference spectral analysis; and a predictive value of an acetylation state for liver cancer metastasis can be investigated.
Owner:FUDAN UNIV

Brown tide algae species detection method and kit

The invention relates to a brown tide algae species detection method which comprises the following steps: 1) designing and synthesizing specific primers AanF and AanR and an Aan probe, wherein the sequence of the AanF is AAAGCTCGTAGTTGGATTCCTGG; the sequence of the AanR is GTGTTCAACGCACGCTTACG; the sequence of the Aan probe is CTTGCGATGGTCTATCCT; 2) selecting a standard algal strain and constructing a recombinant plasmid standard; 3) constructing a standard curve; 4) verifying the specificities of the primers AanF and AanR and the Aan probe; 5) performing sample detection and result analysis. The detection method provided by the invention can be used for qualitative and quantitative detection of a brown tide algae species and has the advantages of high sensitivity, good reproducibility, continuous measurement, good convenience and high simplicity in operation, high easiness in control, short analysis time and the like.
Owner:CHINESE RES ACAD OF ENVIRONMENTAL SCI

Method using Raman spectrum to detect beta-carotene content in fruit

ActiveCN105675582AConvenient frequency shift bandEasy to find the frequency shift bandRaman scatteringNon destructiveBeta-Carotene
The invention discloses a method using Raman spectrum to detect beta-carotene content in fruit. The method includes: using the Raman spectrum to perform non-destructive detection on a fruit sample, using high performance liquid chromatography to perform chemical detection at the same time, comparing the detection results of the non-destructive detection and the chemical detection, performing scientific mathematical deduction to obtain the mapping relation between the non-destructive detection and the chemical detection, and using the Raman spectrum to detect data through the mapping relation so as to obtain the beta-carotene content suitable for the fruit. The method is fast in detection, free of sample destruction, high in sensitivity, and the like.
Owner:ZHEJIANG UNIV

Characterization method for quantifying carbide loss in hot spraying preparation of carbide cermet coating

InactiveCN101942629ARapid Quantitative DetectionFlexible quantitative detectionMolten spray coatingCarbideDeposition process
The invention discloses a characterization method for quantifying carbide loss in the hot spraying preparation of a carbide cermet coating, which comprises the following steps: comparing the carbon contents of coatings deposited under water and on a matrix under the conditions of different gas flows and oxygen flows, acquiring the change of the carbon content in the flying process of particles and after collision, and quantifying the carbon loss caused by oxidation and rebound of the particles. The method for quantifying the carbon loss of each phase in the deposition process of the carbide cermet coating based on experiment has the advantage of simple process, and can quickly, flexibly and conveniently quantify and detect the carbon loss in different phases in the hot spraying preparation process of the carbide cermet coating, thereby providing a research method for the preparation process and the performance optimization of the hot spraying carbide cermet coating structure.
Owner:JIUJIANG UNIVERSITY

Extracting and detecting method for flavonoid in radix sophorae subprostratae

The invention provides an extracting and detecting method for flavonoid in radix sophorae subprostratae. The flavonoid to be detected is lupinifolin and radix sophorae subprostratae chroman flavanone C which are respectively called flavone 1 and flavone 4 for short. The extracting and detecting method disclosed by the invention creatively combines a matrix solid-phase dispersion extraction technology with a reverse micro-emulsion electrokinetic chromatography technology, utilizes combination of an offline enrichment technology and an online enrichment technology to achieve secondary enrichment of the flavonoid in the radix sophorae subprostratae and is beneficial to quantitative detection of the flavonoid in the radix sophorae subprostratae. Furthermore, the extracting and detecting method disclosed by the invention is implemented in a microscale system, the used medical materials and experiment drug reagents are all in a microgram level, the use amount of harmful chemical reagents is small, and safety, economical performance and environmental friendliness are achieved.
Owner:ZHEJIANG UNIV OF TECH

Inhibition quantitative detector and inhibition quantitative detection method using inhibition quantitative detector

The invention relates to an inhibition quantitative detector and an inhibition quantitative detection method using the inhibition quantitative detector. A binocular dichoptic effect is achieved by adopting a polarizer, so that the influence of a color lens on an examination result is reduced; a sighting mark with content rather than a spot light source is adopted as a viewing target, so that whether two eyes are balanced can be easier and more objectively judged by a detected person; and the same visual effect of the two eyes is achieved by changing light transmittance of an ND filter, so that a visual inhibition degree can be conveniently and rapidly quantitatively detected.
Owner:SCHOOL OF OPHTHALMOLOGY & OPTOMETRY WENZHOU MEDICAL COLLEGE

Nucleic acid quantitative detection kit for transgenic rice TT51-1

InactiveCN103361409AAccurate and precise contentGood for quantitative detectionMicrobiological testing/measurementGenetically modified riceReference genes
The invention relates to a nucleic acid quantitative detection method and a detection kit for transgenic rice TT51-1. According to the method and the kit disclosed by the invention, the best endogenous reference gene RBE4 which has an optimal effect and is suitable for the detection of the transgenic rice is screened out; through optimization of a real-time fluorescent quantitative PCR (polymerase chain reaction) system, a PCR system for optimal quantitative detection of the transgenic rice TT51-1 or a product thereof is found. According to the method, the precise content of the transgenic component in the transgenic rice TT51-1 or the product thereof can be rapidly and correctly obtained.
Owner:NAT INST OF METROLOGY CHINA

Prussian blue-based electrochemical immunosensor, electrochemical immunosensing method built based on sensor and application

The invention discloses a Prussian blue-based electrochemical immunosensor, an electrochemical immunosensing method built based on the sensor and application. The electrochemical immunosensor is composed of a glassy carbon electrode serving as a base electrode, and a glycan-Prussian blue nanocomposite, gold nanoparticles and a tumor marker capture antibody which are modified on the surface of thebase electrode in sequence. The electrochemical immunosensor is combined with a urease functionalized silicon nanoprobe to determine the content of a tumor marker in a sample. The Prussian blue-basedelectrochemical immunosensor has high analysis properties such as simple preparation process, controllability, high stability, high sensitivity, wide linear range and low cost, and has an extremely practical prospect in the field of clinical tumor marker detection.
Owner:HUBEI NORMAL UNIV

Raman spectrum quantitative analysis method for organic matters in titanium tetrachloride

The invention discloses a Raman spectrum quantitative analysis method for organic matters in titanium tetrachloride. The method comprises the following steps of S1, preparing a standard sample, wherein volume content of each organic matter in the standard sample is known; S2, measuring Raman spectrum of the obtained standard sample, thereby obtaining standard sample Raman spectrum data and baseline data; S3, obtaining standard sample corrected spectrum data according to the standard sample Raman spectrum data and baseline data, and computing a spectrum intensity ratio of the organic matters inthe standard sample according to the standard sample corrected spectrum data; S4, drawing a standard curve; and S5, detecting and analyzing a to-be-detected sample. According to the method, glass capillaries which are very cheap and are easy to get are taken as Raman detection carriers, so detection cost is low; after two ends of the glass capillaries are melted and sealed, the titanium tetrachloride is isolated from external air, so the sample can be stored for a long time; and a detection error resulting from hydrolysis of the titanium tetrachloride can be avoided, so detection accuracy isimproved.
Owner:CHONGQING UNIVERSITY OF SCIENCE AND TECHNOLOGY

Determination of yeast RNA (Ribonucleic Acid) by photoluminescence of ruthenium-based metal complex

The invention discloses a method for quantitatively determining the concentration of yeast RNA (Ribonucleic Acid) in a water solution with a fluorescent spectrometry by applying three types of ruthenium complexes. The method has high sensitivity.
Owner:BEIJING NORMAL UNIVERSITY

Modularized upconversion fluorescent tomography test paper exciting device

The invention discloses a modularized upconversion fluorescent tomography test paper exciting device. The modularized upconversion fluorescent tomography test paper exciting device comprises an uppercasing and a lower casing which are detachably connected, wherein a laser device, an optical detection box and a circuit unit are integrated into the lower casing; the circuit unit is used for providing a power source for the laser device; the infrared light transmitted by the laser device is filtered to remove clutter by a dichroism light filter in the optical detection box, and then reaches a to-be-tested upconversion fluorescent test paper strip; upconversion fluorescent particles on the tomography upconversion fluorescent test paper strip are excited to produce visible light; when the visible light passes through the dichroism light filter, the visible light is vertically reflected, then passes through an infrared light filter, and finally enters a focusing lens; the infrared light filter is used for reducing the influence to the shooting results by the exciting light; a user can directly observe and obtain the color developing result of the test paper via an observing hole. The modularized upconversion fluorescent tomography test paper exciting device has the advantages that the whole structure is compact, the external power source is not needed, hundreds of samples can be continuously detected, and the user can conveniently perform quantitative detection on the upconversion fluorescent tomography test paper at any time and any place.
Owner:XI AN JIAOTONG UNIV

Selective medium for quantitative determination of V.anguillarum and its preparation

The invention discloses a selective culture medium for the quantitative determination of Vibrio anguillarum and its preparing process, wherein the culture medium comprises sorbic alcohol 15g, yeast powder or yeast grease 2-5g, NaCl 20-60g, ampictllin 5mg, cresol red 40mg, bromothymol blue 40mg, gelose 12-20g, and distilled water 1000ml.
Owner:INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Signal-enhanced type near infrared fluorescence probe, preparation method thereof and application

The invention provides a signal-enhanced type near infrared fluorescence probe, wherein the chemical structural formula is shown as FORMULA (1); in Formula (I), X1 is -S or -Se-, R' is C1-12 alkylene, X2 is -C(CH3)2-, -O-, -S- or Se-; R1 and R2 are independently selected from H atom, C1-18 alkyl or radical groups shown in SO3R5, wherein R5 is C1-18 alkyl or benzyl; R3 and R4 are independently selected from C1-18 alkyl or benzyl; Y is fluorine, chlorine, bromine or iodine. The activating and emitting lights of the probe are located in the near infrared zone; the stocks displacement is big, the background disturbance is few; the probe has high sensitivity and high selectivity for sulfur alcohol; meanwhile, the probe is low in toxicity, small in harm of cell and living body, and very suitable for detecting sulfur alcohol in a biological body. The invention further provides a preparation method of the probe and an application thereof.
Owner:SHENZHEN INST OF ADVANCED TECH

Sensor electrode for detecting hydrogen peroxide in food processing as well as preparation method thereof

The invention discloses a sensor electrode for detecting hydrogen peroxide in food processing as well as a preparation method thereof. The preparation method comprises the following steps: preparing carbon nanotube / coprous oxide composite material suspension liquid; adding the suspension liquid on an electrode dropwise to obtain a carbon nanotube / coprous oxide composite material modified electrode; and loading gold nanoparticles on the carbon nanotube / coprous oxide composite material layer by an electrochemical deposition method to obtain a hydrogen peroxide electrochemical sensor. The electrochemical sensor is applied to detection of the hydrogen peroxide; and the prepared electrochemical sensor has very high response sensitivity on the hydrogen peroxide at room temperature and can be widely applied in the fields of accurate measurement and control of low-concentration hydrogen peroxide in the industrial and agricultural production process and in the atmosphere environment. The invention also provides application of the gas sensor. The electrochemical sensor has the advantages of simplicity and convenience in preparation, low cost and the like, and is suitable for batch production.
Owner:CHENDU NEW KELI CHEM SCI CO LTD

Multifunctional papermaking pulping system

The invention provides a multifunctional papermaking pulping system. The system comprises a washing frame, a charging hopper, a spraying guide pipe structure, a water guide pipe, a water pump, a waterpumping pipe, a water circulating filter residue net rack structure, a water storage tank, a waste paper rotating scraping bracket structure, a guiding hopper, a waste paper crushing box, a top mounting plate, a drive shaft, crushing blades, a quantitative bleaching powder adding storage tank structure, a finished product box and a longitudinal support, wherein the charging hopper is mounted at the upper left part of the washing frame through bolts. By means of water spraying heads, water spraying pipes and first-grade adjusting valves, waste paper in the washing frame can be conveniently wetted; by means of the water guiding hopper, a water draining barrel and the water storage tank, the waste paper in the washing frame can be conveniently circulated in the water storage tank, and wastewater can be further recycled; by means of scale marks and second-grade adjusting valves, bleaching powder in the bleached powder storage tank can be conveniently and quantitatively detected, and bleaching powder is conveniently added to the waste paper crushing box.
Owner:HUBEI BAOTA PAPER

Internal reference-containing kit for quantificationally detecting HCV with fluorescence RT-PCR technology

The invention relates to an internal reference-containing kit and a method for quickly, conveniently and quantificationally detecting HCV virus RNA with the fluorescence RT-PCR technology. The invention designs a detection primer and a probe for HCV gene sequence conserved fragments, carries out qualitative and quantificational detection on the HCV virus RNA by using the improved one-step method RT-PCR real-time amplification technology, and has the advantages of simpleness for operation, good repeatability as well as higher specificity and sensitivity.
Owner:SHANGHAI XINGYAO MED TECH DEV CO LTD +1

Nucleic acid quantitative detection kit for transgenic rice No.2 Ke-Ming-Dao (KMD) rice

The invention relates to a nucleic acid quantitative detection method and a detection kit for transgenic rice No.2 Ke-Ming-Dao (KMD) rice. According to the method and the kit disclosed by the invention, an endogenous reference gene RBE4 which has an optimal effect and is suitable for detection is screened out, and a PCR (polymerase chain reaction) system suitable for quantitative detection is found, so that the precise content of a transgenic component in the transgenic rice No.2 KMD rice or a product thereof can be rapidly and correctly obtained. The invention also relates to a method for correcting the bias between a detection value and a real value in transgenic organism quantitative detection. According to the method, the ratio of nucleic acid extraction efficiencies of a transgenic organism and a receptor non-transgenic organism is calculated to be used as a correction coefficient, thus the real correct content of the transgenic component can be obtained.
Owner:NAT INST OF METROLOGY CHINA

Specific primer for detecting mRNA expression levels of MSTN genes of cows and fluorescent quantitative detecting kit

InactiveCN104894266AConvenient and fast quantitative detectionMonitor growth and development statusMicrobiological testing/measurementDNA/RNA fragmentationPhysiologyNucleotide
The invention provides a specific primer for detecting the mRNA expression levels of MSTN genes of cows. The specific primer is characterized by having the nucleotide sequence as follows: an upstream primer has the sequence: 5'-AACCAGGAGAAGATGGAC-3'; and a downstream primer has the sequence: 5'-TTAGAGGGTAACGACAGC-3'. The invention also provides a corresponding fluorescent quantitative PCR detecting kit. The specific primer can be used for achieving the aims of conveniently, rapidly and quantitatively detecting the mRNA transcriptional levels of MSTN genes, monitoring the muscle growth and development states of different cows (including milk cows, cattle and yaks), different tissues and different periods and also identifying diseases related to cow muscle dysplasia. The specific primer has the advantages of high sensitivity, good stability and low experimental cost on the aspect of detecting the transcriptional levels of the genes.
Owner:LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS

Electrochemical sensor and preparation method and application thereof

The invention relates to the technical field of functional materials and sensors, in particular to an electrochemical sensor and a preparation method and an application thereof. The electrochemical sensor comprises an electrode and a multiwalled carbon nanotube-polyoxometallate-gold nanoparticle composite material coated to the surface of the electrode. The multiwalled carbon nanotube is acidified. The polyoxometallate is tungsten copper heteropolic undecasilicate. The electrochemical sensor has the characteristics of being wide in linear range, high in sensitivity and stability and good in repeatability, can qualitatively and quantitively detect acetaminophen accurately and conveniently, and is convenient to detect and relatively short in consumed time.
Owner:HEBEI UNIVERSITY OF SCIENCE AND TECHNOLOGY

Method for rapidly detecting phenyllactic acid content by using reversed-phase high performance liquid chromatography

The invention discloses a method for rapidly detecting a phenyllactic acid content by using reversed-phase high performance liquid chromatography and belongs to the food detection technology field. Chromatographic conditions comprise that a C18 chromatographic column (4.6*250 mm, 5mum) is included; a mobile phase A is a 0.05% trifluoroacetic acid water solution; a mobile phase B is acetonitrile, and the volume ratio of mobile phases A and B is 3:1; a flow rate is 1 mL / min; a sample size is 10 muL; a chromatographic column temperature is 20-30 DEG C; and a detection wavelength is 210 nm. Impurities and phenyllactic acid in a sample to be tested are separated, the content of the phenyllactic acid is detected, and qualitative and quantitative operation is performed on the phenyllactic acid through retention time and a peak area. The operation of the method is simple, detection is rapid, cost is low, qualitative and quantitative operation is accurate, separation with an impurity peak can be achieved, and the method is suitable for the rapid batch detection of a total phenyllactic acid amount in food and a fermentation solution.
Owner:SHANGHAI OCEAN UNIV

Electrified detection device and method for content of water in electric insulation oil

An embodiment of the invention provides an electrified detection device for the content of water in electric insulation oil. The device comprises an oscillation frequency counter, an oil sample constant-temperature detection cavity and a crystal oscillator; the surface of the crystal oscillator is coated with a hydrophilic coating, and the crystal oscillator is mounted in the oil sample constant-temperature detection cavity and used for generating oscillation frequencies and transmitting the oscillation frequencies to the oscillation frequency counter; the crystal oscillator is mounted in theoil sample constant-temperature detection cavity, and the oil sample constant-temperature detection cavity is used for containing the electric insulation oil; and the oscillation frequency counter isconnected with the crystal oscillator and used for recording the oscillation frequencies generated by the crystal oscillator and acquiring the content of water in the electric insulation oil accordingto the change of the oscillation frequencies generated by the crystal oscillator. An embodiment of the invention further provides an electrified detection method for the content of the water in the electric insulation oil. The method is realized by the device. According to the device and the method, under the condition that an oil sample is obtained in an electrified manner on site of electricalequipment, rapid, convenient and accurate quantitative detection of the content of the water in the electric insulation oil can be realized.
Owner:STATE GRID HUNAN ELECTRIC POWER +2

Electrochemical method for detecting capsaicin in food

The invention discloses an electrochemical method for detecting capsaicin in food. The electrochemical method specifically comprises the following steps of: (1) preparing a silk-screen printed carbon electrode; (2) preparing a capsaicin standard solution; (3) drawing a standard curve, specifically, taking a silk-screen printed carbon electrode as a working electrode, a saturated calomel electrode as a reference electrode and a platinum wire electrode as a counter electrode to obtain a three-electrode system, then inserting the three-electrode system into the capsaicin standard solution, performing stirring for enriching, and performing scanning to obtain a linear regression equation, and drawing the standard curve; (4) preparing a liquid to be detected; and (5) performing detecting. According to the method, the unmodified silk-screen printed carbon electrode is used as an electrode material; the differential pulse-adsorption stripping voltammetry is adopted; the linear relation between an electrochemical response signal and the concentration of a to-be-detected substance is employed; the detection sensitivity can be greatly improved; the background current can be effectively reduced; and simple, convenient, rapid and accurate quantitative detection of capsaicin can be achieved.
Owner:HENAN INST OF SCI & TECH

Method for error correction in transgenic organism quantitative determination

The invention relates to a method for error correction in transgenic organism quantitative determination. According to the method for error correction, a ratio of nucleic acid extraction ratios of a transgenic organism to a receptor non-transgenic organism is calculated and is used as a correction coefficient and real and accurate content of the transgenic component is obtained according to the correction coefficient.
Owner:NAT INST OF METROLOGY CHINA

Two-photon fluorescent probe for detecting Cu (II) and preparation method and application of two-photon fluorescent probe

The invention discloses a two-photon fluorescent probe for detecting Cu (II) and a preparation method and application of the two-photon fluorescent probe. The preparation method includes the steps offirstly, adding 4-bromine-1, 8-anhydride naphthalene and N-(2-amino ethyl) morpholine into a round-bottom flask A, adding ethanol into the round-bottom flask A, placing the round-bottom A in oil bath,stirring the solution in the round-bottom flask A with a magnetic stirrer, and performing suction filtration on the reaction system while the reaction system is hot to obtain a compound A; secondly,adding the compound A obtained in the first step and hydroxyethyl piperazine into a round-bottom flask B, adding ethylene glycol monomethyl ether until the compound A is completely dissolved, placingthe round-bottom flask B in oil bath, stirring the solution in the round-bottom flask B with a magnetic stirrer to obtain a solution A; thirdly, using an eluting agent comprising dichloromethane and methanol to perform column chromatography separation to obtain the two-photon fluorescent probe. The two-photon fluorescent probe is applied to the targeting two-photon fluorescent imaging detection ofthe Cu (II) in cell lysosome.
Owner:SHAANXI UNIV OF SCI & TECH

Image-type device and method for quantitative determination of infrared reflectivity and transmissivity

The invention provides an image-type device and a method for quantitative determination of infrared reflectivity and transmissivity. The method comprises firstly calibrating the reflectivity and the transmissivity of calibration cards with a plurality of different reflectivity or transmissivity, secondly collecting reflected and transmitted images of the calibration cards and to-be-detected objects under illumination of infrared LED light sources, and performing linearity interpolation in accordance with the reflectivity values and the transmissivity values of the calibration cards to obtain the reflectivity values and the transmissivity values of the to-be-detected objects at any positions in an imaging area, thereby realizing the quantitative determination of the reflectivity and the transmissivity. According to the invention, the above detection can be carried out for prints printed with infrared ink or white watermark, and thus printing quality can be effectively controlled. The method and the device are convenient and fast, flexible in function, and strong in expansibility, and can adjust optical devices and software configuration of host computers for different applications, thereby achieving detection requirements.
Owner:CHINA BANKNOTE SECURITY PRINTING TECH RES INST CO LTD +1