81results about How to "Convenient Quantitative Detection" patented technology

The invention discloses a stem-loop structured combined probe and application thereof. The probe is constituted by two DNA sequences of stem-loop structures; from 5' terminals to 3' terminals, probe I and probe II sequentially include stem-loop zones and detection object recognition zones, and are applicable to telomerase activity, RNA and DNA detection and telomerase inhibitor screening; when a detection object is telomerase, the detection object recognition zone of the probe I is a telomerase substrate sequence, and the detection object recognition zone of the probe II is a sequence which is complementary with 8-40 bases in a telomerase extension sequence; and when the detection object is RNA or DNA, the detection object recognition zone of the probe I is a sequence which is complementary with 8-40 bases, close to the 3' terminal, of to-be-detected RAN or DNA, and the detection object recognition zone of the probe II is a sequence which is equal to 8-40 bases, close to the 5' terminal, of the to-be-detected RAN or DNA. The combined probe disclosed by the invention is unnecessary to make use of fluorescence labeling and radioactive element labeling, and the combined probe, with the specific stem-loop structure, provides a specific amplification template for a nucleic acid amplification reaction, so that rapid signal amplification under constant temperature is achieved; and the combined probe is high in sensitivity and amplification efficiency.

The invention belongs to the technical field of biology, and particularly discloses a method for quantitatively detecting a protein acetylation level. The method particularly comprises the steps of preparing protein chips, drawing standard curves and detecting actual samples. The method overcomes the defects that antibodies have weak affinities and acetylated protein is difficult to enrich efficiently when acetylation antibodies are subjected to immune precipitation enriching directly; the protein acetylation level can be quantitatively detected quickly and simply; the used sample amount is less; the difference comparison among the different samples is facilitated; the study of an acetylation difference spectrogram provides a technology platform for establishing high-flux protein acetylation difference spectral analysis; and a predictive value of an acetylation state for liver cancer metastasis can be investigated.

The invention relates to a brown tide algae species detection method which comprises the following steps: 1) designing and synthesizing specific primers AanF and AanR and an Aan probe, wherein the sequence of the AanF is AAAGCTCGTAGTTGGATTCCTGG; the sequence of the AanR is GTGTTCAACGCACGCTTACG; the sequence of the Aan probe is CTTGCGATGGTCTATCCT; 2) selecting a standard algal strain and constructing a recombinant plasmid standard; 3) constructing a standard curve; 4) verifying the specificities of the primers AanF and AanR and the Aan probe; 5) performing sample detection and result analysis. The detection method provided by the invention can be used for qualitative and quantitative detection of a brown tide algae species and has the advantages of high sensitivity, good reproducibility, continuous measurement, good convenience and high simplicity in operation, high easiness in control, short analysis time and the like.

The invention discloses a method using Raman spectrum to detect beta-carotene content in fruit. The method includes: using the Raman spectrum to perform non-destructive detection on a fruit sample, using high performance liquid chromatography to perform chemical detection at the same time, comparing the detection results of the non-destructive detection and the chemical detection, performing scientific mathematical deduction to obtain the mapping relation between the non-destructive detection and the chemical detection, and using the Raman spectrum to detect data through the mapping relation so as to obtain the beta-carotene content suitable for the fruit. The method is fast in detection, free of sample destruction, high in sensitivity, and the like.

The invention discloses a characterization method for quantifying carbide loss in the hot spraying preparation of a carbide cermet coating, which comprises the following steps: comparing the carbon contents of coatings deposited under water and on a matrix under the conditions of different gas flows and oxygen flows, acquiring the change of the carbon content in the flying process of particles and after collision, and quantifying the carbon loss caused by oxidation and rebound of the particles. The method for quantifying the carbon loss of each phase in the deposition process of the carbide cermet coating based on experiment has the advantage of simple process, and can quickly, flexibly and conveniently quantify and detect the carbon loss in different phases in the hot spraying preparation process of the carbide cermet coating, thereby providing a research method for the preparation process and the performance optimization of the hot spraying carbide cermet coating structure.

The invention provides an extracting and detecting method for flavonoid in radix sophorae subprostratae. The flavonoid to be detected is lupinifolin and radix sophorae subprostratae chroman flavanone C which are respectively called flavone 1 and flavone 4 for short. The extracting and detecting method disclosed by the invention creatively combines a matrix solid-phase dispersion extraction technology with a reverse micro-emulsion electrokinetic chromatography technology, utilizes combination of an offline enrichment technology and an online enrichment technology to achieve secondary enrichment of the flavonoid in the radix sophorae subprostratae and is beneficial to quantitative detection of the flavonoid in the radix sophorae subprostratae. Furthermore, the extracting and detecting method disclosed by the invention is implemented in a microscale system, the used medical materials and experiment drug reagents are all in a microgram level, the use amount of harmful chemical reagents is small, and safety, economical performance and environmental friendliness are achieved.

The invention relates to an inhibition quantitative detector and an inhibition quantitative detection method using the inhibition quantitative detector. A binocular dichoptic effect is achieved by adopting a polarizer, so that the influence of a color lens on an examination result is reduced; a sighting mark with content rather than a spot light source is adopted as a viewing target, so that whether two eyes are balanced can be easier and more objectively judged by a detected person; and the same visual effect of the two eyes is achieved by changing light transmittance of an ND filter, so that a visual inhibition degree can be conveniently and rapidly quantitatively detected.

The invention relates to a nucleic acid quantitative detection method and a detection kit for transgenic rice TT51-1. According to the method and the kit disclosed by the invention, the best endogenous reference gene RBE4 which has an optimal effect and is suitable for the detection of the transgenic rice is screened out; through optimization of a real-time fluorescent quantitative PCR (polymerase chain reaction) system, a PCR system for optimal quantitative detection of the transgenic rice TT51-1 or a product thereof is found. According to the method, the precise content of the transgenic component in the transgenic rice TT51-1 or the product thereof can be rapidly and correctly obtained.

The invention discloses a Prussian blue-based electrochemical immunosensor, an electrochemical immunosensing method built based on the sensor and application. The electrochemical immunosensor is composed of a glassy carbon electrode serving as a base electrode, and a glycan-Prussian blue nanocomposite, gold nanoparticles and a tumor marker capture antibody which are modified on the surface of thebase electrode in sequence. The electrochemical immunosensor is combined with a urease functionalized silicon nanoprobe to determine the content of a tumor marker in a sample. The Prussian blue-basedelectrochemical immunosensor has high analysis properties such as simple preparation process, controllability, high stability, high sensitivity, wide linear range and low cost, and has an extremely practical prospect in the field of clinical tumor marker detection.

The invention discloses a Raman spectrum quantitative analysis method for organic matters in titanium tetrachloride. The method comprises the following steps of S1, preparing a standard sample, wherein volume content of each organic matter in the standard sample is known; S2, measuring Raman spectrum of the obtained standard sample, thereby obtaining standard sample Raman spectrum data and baseline data; S3, obtaining standard sample corrected spectrum data according to the standard sample Raman spectrum data and baseline data, and computing a spectrum intensity ratio of the organic matters inthe standard sample according to the standard sample corrected spectrum data; S4, drawing a standard curve; and S5, detecting and analyzing a to-be-detected sample. According to the method, glass capillaries which are very cheap and are easy to get are taken as Raman detection carriers, so detection cost is low; after two ends of the glass capillaries are melted and sealed, the titanium tetrachloride is isolated from external air, so the sample can be stored for a long time; and a detection error resulting from hydrolysis of the titanium tetrachloride can be avoided, so detection accuracy isimproved.

The invention discloses a method for quantitatively determining the concentration of yeast RNA (Ribonucleic Acid) in a water solution with a fluorescent spectrometry by applying three types of ruthenium complexes. The method has high sensitivity.

The invention discloses a selective culture medium for the quantitative determination of Vibrio anguillarum and its preparing process, wherein the culture medium comprises sorbic alcohol 15g, yeast powder or yeast grease 2-5g, NaCl 20-60g, ampictllin 5mg, cresol red 40mg, bromothymol blue 40mg, gelose 12-20g, and distilled water 1000ml.

The invention provides a signal-enhanced type near infrared fluorescence probe, wherein the chemical structural formula is shown as FORMULA (1); in Formula (I), X1 is -S or -Se-, R' is C1-12 alkylene, X2 is -C(CH3)2-, -O-, -S- or Se-; R1 and R2 are independently selected from H atom, C1-18 alkyl or radical groups shown in SO3R5, wherein R5 is C1-18 alkyl or benzyl; R3 and R4 are independently selected from C1-18 alkyl or benzyl; Y is fluorine, chlorine, bromine or iodine. The activating and emitting lights of the probe are located in the near infrared zone; the stocks displacement is big, the background disturbance is few; the probe has high sensitivity and high selectivity for sulfur alcohol; meanwhile, the probe is low in toxicity, small in harm of cell and living body, and very suitable for detecting sulfur alcohol in a biological body. The invention further provides a preparation method of the probe and an application thereof.

The invention relates to an internal reference-containing kit and a method for quickly, conveniently and quantificationally detecting HCV virus RNA with the fluorescence RT-PCR technology. The invention designs a detection primer and a probe for HCV gene sequence conserved fragments, carries out qualitative and quantificational detection on the HCV virus RNA by using the improved one-step method RT-PCR real-time amplification technology, and has the advantages of simpleness for operation, good repeatability as well as higher specificity and sensitivity.

The invention relates to a nucleic acid quantitative detection method and a detection kit for transgenic rice No.2 Ke-Ming-Dao (KMD) rice. According to the method and the kit disclosed by the invention, an endogenous reference gene RBE4 which has an optimal effect and is suitable for detection is screened out, and a PCR (polymerase chain reaction) system suitable for quantitative detection is found, so that the precise content of a transgenic component in the transgenic rice No.2 KMD rice or a product thereof can be rapidly and correctly obtained. The invention also relates to a method for correcting the bias between a detection value and a real value in transgenic organism quantitative detection. According to the method, the ratio of nucleic acid extraction efficiencies of a transgenic organism and a receptor non-transgenic organism is calculated to be used as a correction coefficient, thus the real correct content of the transgenic component can be obtained.

The invention provides a specific primer for detecting the mRNA expression levels of MSTN genes of cows. The specific primer is characterized by having the nucleotide sequence as follows: an upstream primer has the sequence: 5'-AACCAGGAGAAGATGGAC-3'; and a downstream primer has the sequence: 5'-TTAGAGGGTAACGACAGC-3'. The invention also provides a corresponding fluorescent quantitative PCR detecting kit. The specific primer can be used for achieving the aims of conveniently, rapidly and quantitatively detecting the mRNA transcriptional levels of MSTN genes, monitoring the muscle growth and development states of different cows (including milk cows, cattle and yaks), different tissues and different periods and also identifying diseases related to cow muscle dysplasia. The specific primer has the advantages of high sensitivity, good stability and low experimental cost on the aspect of detecting the transcriptional levels of the genes.

The invention relates to the technical field of functional materials and sensors, in particular to an electrochemical sensor and a preparation method and an application thereof. The electrochemical sensor comprises an electrode and a multiwalled carbon nanotube-polyoxometallate-gold nanoparticle composite material coated to the surface of the electrode. The multiwalled carbon nanotube is acidified. The polyoxometallate is tungsten copper heteropolic undecasilicate. The electrochemical sensor has the characteristics of being wide in linear range, high in sensitivity and stability and good in repeatability, can qualitatively and quantitively detect acetaminophen accurately and conveniently, and is convenient to detect and relatively short in consumed time.

The invention discloses a method for rapidly detecting a phenyllactic acid content by using reversed-phase high performance liquid chromatography and belongs to the food detection technology field. Chromatographic conditions comprise that a C18 chromatographic column (4.6*250 mm, 5mum) is included; a mobile phase A is a 0.05% trifluoroacetic acid water solution; a mobile phase B is acetonitrile, and the volume ratio of mobile phases A and B is 3:1; a flow rate is 1 mL/min; a sample size is 10 muL; a chromatographic column temperature is 20-30 DEG C; and a detection wavelength is 210 nm. Impurities and phenyllactic acid in a sample to be tested are separated, the content of the phenyllactic acid is detected, and qualitative and quantitative operation is performed on the phenyllactic acid through retention time and a peak area. The operation of the method is simple, detection is rapid, cost is low, qualitative and quantitative operation is accurate, separation with an impurity peak can be achieved, and the method is suitable for the rapid batch detection of a total phenyllactic acid amount in food and a fermentation solution.

An embodiment of the invention provides an electrified detection device for the content of water in electric insulation oil. The device comprises an oscillation frequency counter, an oil sample constant-temperature detection cavity and a crystal oscillator; the surface of the crystal oscillator is coated with a hydrophilic coating, and the crystal oscillator is mounted in the oil sample constant-temperature detection cavity and used for generating oscillation frequencies and transmitting the oscillation frequencies to the oscillation frequency counter; the crystal oscillator is mounted in theoil sample constant-temperature detection cavity, and the oil sample constant-temperature detection cavity is used for containing the electric insulation oil; and the oscillation frequency counter isconnected with the crystal oscillator and used for recording the oscillation frequencies generated by the crystal oscillator and acquiring the content of water in the electric insulation oil accordingto the change of the oscillation frequencies generated by the crystal oscillator. An embodiment of the invention further provides an electrified detection method for the content of the water in the electric insulation oil. The method is realized by the device. According to the device and the method, under the condition that an oil sample is obtained in an electrified manner on site of electricalequipment, rapid, convenient and accurate quantitative detection of the content of the water in the electric insulation oil can be realized.

The invention discloses an electrochemical method for detecting capsaicin in food. The electrochemical method specifically comprises the following steps of: (1) preparing a silk-screen printed carbon electrode; (2) preparing a capsaicin standard solution; (3) drawing a standard curve, specifically, taking a silk-screen printed carbon electrode as a working electrode, a saturated calomel electrode as a reference electrode and a platinum wire electrode as a counter electrode to obtain a three-electrode system, then inserting the three-electrode system into the capsaicin standard solution, performing stirring for enriching, and performing scanning to obtain a linear regression equation, and drawing the standard curve; (4) preparing a liquid to be detected; and (5) performing detecting. According to the method, the unmodified silk-screen printed carbon electrode is used as an electrode material; the differential pulse-adsorption stripping voltammetry is adopted; the linear relation between an electrochemical response signal and the concentration of a to-be-detected substance is employed; the detection sensitivity can be greatly improved; the background current can be effectively reduced; and simple, convenient, rapid and accurate quantitative detection of capsaicin can be achieved.

The invention discloses a two-photon fluorescent probe for detecting Cu (II) and a preparation method and application of the two-photon fluorescent probe. The preparation method includes the steps offirstly, adding 4-bromine-1, 8-anhydride naphthalene and N-(2-amino ethyl) morpholine into a round-bottom flask A, adding ethanol into the round-bottom flask A, placing the round-bottom A in oil bath,stirring the solution in the round-bottom flask A with a magnetic stirrer, and performing suction filtration on the reaction system while the reaction system is hot to obtain a compound A; secondly,adding the compound A obtained in the first step and hydroxyethyl piperazine into a round-bottom flask B, adding ethylene glycol monomethyl ether until the compound A is completely dissolved, placingthe round-bottom flask B in oil bath, stirring the solution in the round-bottom flask B with a magnetic stirrer to obtain a solution A; thirdly, using an eluting agent comprising dichloromethane and methanol to perform column chromatography separation to obtain the two-photon fluorescent probe. The two-photon fluorescent probe is applied to the targeting two-photon fluorescent imaging detection ofthe Cu (II) in cell lysosome.