Check patentability & draft patents in minutes with Patsnap Eureka AI!

Detection method of mycobacterium tuberculosis pyrazinamide drug resistance

A technology of mycobacterium tuberculosis and pyrazinamide, which is applied in the direction of biochemical equipment and methods, microbiological determination/inspection, etc., can solve the problems of increasing detection complexity and cost, increasing detection time and cost, and ineffective effects, etc. Achieve high sensitivity and specificity, low cost, and simple steps

Inactive Publication Date: 2011-09-07
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the rabbit reticulocyte expression system, the solution is dark red, which is close to the color of the reaction product measured by pyrazinamidase activity. The solution needs to be decolorized, which increases the detection time and cost, and incomplete decolorization will also bring new problems. error
In this report, the wheat germ expression system was also used, but the effect was not obvious, and the detection sensitivity was many times worse than that of rabbit reticulocytes
In addition, the PCR primers used in this report are partly related to pncA The gene sequence overlaps, and the PCR primers cover part of the pncA Gene mutation sites, resulting in the need to use at least two pairs of primers to completely detect a Mycobacterium tuberculosis resistance to pyrazinamide, which increases the complexity and cost of detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of mycobacterium tuberculosis pyrazinamide drug resistance
  • Detection method of mycobacterium tuberculosis pyrazinamide drug resistance
  • Detection method of mycobacterium tuberculosis pyrazinamide drug resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] PCR Amplification of Full-length Mycobacterium tuberculosis Pyrazinamidase Gene Primers Containing T7 Promoter-Wheat Germ Cell-Free In Vitro Protein Expression Determination of Pyrazinamide in Tuberculosis Pyrazinamide-Susceptible Strains (H37RA) and Pyrazinamide-Resistant Strains (BCG) drug resistance.

[0031] 1. Boiling and lysing Mycobacterium tuberculosis to quickly prepare templates for PCR reactions:

[0032] Take 1ml of Mycobacterium tuberculosis solution, centrifuge at 4000rpm for 1min, remove the supernatant, collect the bacteria, add 100ul double distilled water and boil for 10min, then centrifuge at 5000rpm for 5min, carefully absorb the supernatant as the amplified pyrazinamidase gene ( pncA) template.

[0033] 2. PCR amplification pncA Gene primer design. Upstream primer sequence P1: 5'-TAATACGACTCACTATAGGCCCGCCCGAACGTAAGGAGGAC-3', downstream primer sequence: 5'-GCCGCCAACAGTTCATCCCGGT-3'.

[0034] PCR amplification conditions:

[0035] Phusion® High-...

Embodiment 2

[0054] Using primers to amplify the full-length pyrazinamidase gene of Mycobacterium tuberculosis with T7 promoter and enhancer-cell-free in vitro protein expression in wheat germ to determine the expression of tuberculosis pyrazinamide-sensitive (H37RA) and pyrazinamide-resistant strains (BCG) Pyrazinamide resistance.

[0055] 1. Boiling and lysing Mycobacterium tuberculosis to quickly prepare templates for PCR reactions:

[0056] Take 1ml of the bacteria solution, centrifuge at 4000rpm for 1min, remove the supernatant, collect the bacteria, add 100ul double distilled water

[0057] Boil for 10min, then 5000rpm, centrifuge for 5min, carefully draw the supernatant as the amplified pyrazinamidase gene ( pncA) template.

[0058] 2. PCR amplification obtained pncA fragments of genes. Upstream primer sequence P2: 5'-TAATACGACTCACTATAGGTATTTTTACACAATTACCAACAACAACAAACAACAAACAATTACAATTACTATTTACAATTACACCCGAACGTAAGGAGGACGT-3' or

[0059] 5'-TAATACGACTCACTATAGGATACTCCCCCACAACAGCTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection method of mycobacterium tuberculosis pyrazinamide drug resistance, comprising the following steps: A. pyrolyzing a template of mycobacterium tuberculosis used for polymerase chain reaction (PCR); B. designing a PCR primer, and augmenting a full-length pyrazinamide (pncA) gene; C. concentrating the augmented pncA gene segment and quantifying; D. expressing pncA enzyme by adopting a wheat germ acellular expression system; and F. determining the expressed pncA enzymatic conversion pyrazinamide into the activity of pyrazine acid; comparing the pncA enzymatic activities of a sensitive strain and a drug resistance strain of the expressed tubercle bacillus standard; and determining the drug resistance of the mycobacterium tuberculosis. The method is characterized in that the drug resistance caused by pncA gene mutation can be determined by a pair of primers, and simultaneously discloses a primer sequence for augmenting the full-length pncA gene from the tubercle bacillus gene group and being suitable for a wheat germ acellular expression system to express the mycobacterium tuberculosis pyrazinamide. By the detection method, the mycobacterium tuberculosis pyrazinamide drug resistance can be rapidly and sensitively detected in no need of bacterial culture.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically relates to a rapid detection method for pyrazinamide drug resistance of Mycobacterium tuberculosis based on a wheat germ cell-free in vitro protein expression system. It can be used for rapid detection of pyrazinamide drug resistance of Mycobacterium tuberculosis. technical background [0002] Tuberculosis is one of the most threatening infectious diseases to humans. Although Mycobacterium bovis vaccine (BCG) and various anti-tuberculosis drugs have been widely used around the world, in recent years, with the increase of population flow and population density, Increased, multidrug-resistant strains of Mycobacterium tuberculosis and double infection with human immunodeficiency virus (HIV), tuberculosis has been raging again in developed and developing countries. According to reports, in 2005, there were about 8.8 million new tuberculosis patients in the world, and about 1.6 mill...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/34C12Q1/02
CPCC12Q1/689C12Q2600/106
Inventor 危宏平周满王殿冰张治平张先恩
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More