Detection method for BRAF gene mutation

An allele and sequence technology, applied in the field of molecular biology method to detect mutant bases, can solve the problems of difficult to meet clinical detection, long detection period, easy pollution, etc., to improve the accuracy and detection efficiency, and the steps are simple. , the effect of saving time and cost

Inactive Publication Date: 2011-10-19
JIANGSU INST OF NUCLEAR MEDICINE
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

DNA direct sequencing method, this method has a long cycle, high cost, low throughput, possible cross-contamination, and the sensitivity is only 20% to 25%; while the RFLP experiment is cumbersome, the detection cycle is long, the cost is high, and the first round of False positives caused by incomplete digestion and easy contamination are difficult to meet the requirements of clinical testing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method for BRAF gene mutation
  • Detection method for BRAF gene mutation
  • Detection method for BRAF gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] 1. Design and synthesis of BRAF gene-specific amplification primers and taqman-MGB probe:

[0031] According to the position and genotype of the mutation site, a pair of gene-specific upstream and downstream amplification primers (the length of the amplification product is 136bp) and taqman-MGB probes with different fluorescein labels for wild-type and mutant BRAF genes were designed. One needle each. Primers and probes were synthesized by Shanghai Jikang Biotechnology Co., Ltd. The specific sequence is as follows.

[0032] BRAF amplification primers:

[0033] BRAF-F1 (forward): 5' CTTACCTAAACTCTTCATAATGCTTGC 3'

[0034] BRAF-R1 (reverse): 5' TAGCCTCAATTCTTACCATCCACA 3'

[0035] BRAF gene wild-type probe: 5'-E-AGCTACAGTGAAATC-P-3'

[0036] BRAF mutant probe: 5'-F-AGCTACAGAGAAATC-P-3'

[0037] Where: E=HEX reporter dye, F=FAM reporter dye, P=Taqman-MGB group

[0038] 2. Extraction of tumor tissue DNA:

[0039] (1) Sample collection: Take 2 cases of fresh tissue b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection method for BRAF gene mutation, comprising the following steps: a) extracting DNA of tumor tissue; b) with the extracted DNA in step a) as the template, carrying out PCR amplification by using a primer pair comprising SEQ (1) and SEQ (2) in a sequence table and Taqman-MGB probes of SEQ (3) and SEQ (4); c) carrying out BRAF allele identification and analysis on products of the amplification in step b). The detection method provided in the invention can assist clinicians in detecting BRAF gene mutation of patients and provide guidance and basis for clinicians to use medicines, and therefore risk in treatment for clinicians and economic burden for patients are reduced. According to the invention, high flux detection is realized and up to 96 samples can be detected at a time; the detection method has a simple process, thereby substantially raising detection accuracy; detection time is short; wild type and mutant alleles can be detected simultaneously; and high sensitivity and good specificity are obtained.

Description

technical field [0001] The invention relates to the detection of mutation bases by means of molecular biology methods. Background technique [0002] There are about 3 billion bases and 40,000 genes in the human genome, distributed on 24 pairs of chromosomes. Each gene encodes a specific protein, regulates biochemical reactions in organisms, and exerts biological functions. Single nucleotide polymorphism (single nucleotide polymorphism, SNP) mainly refers to the DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. It is the most common type of heritable variation in humans. Accounting for more than 90% of all known polymorphisms. SNPs exist widely in the human genome, with an average of 1 in every 500-1000 base pairs, and it is estimated that the total number can reach 3 million or more. Changes in DNA sequence affect many biological functions, such as an individual's susceptibility to disease and its response to drug treatment. I...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor张莉俞惠新宋菲谭成林秀峰
OwnerJIANGSU INST OF NUCLEAR MEDICINE