Multifunctional shuttle vector new pBE2, construction method thereof and method for constructing alkali protease mutation library by using same

A shuttle carrier and construction method technology, which is applied in the direction of microorganism-based methods, biochemical equipment and methods, and the use of vectors to introduce foreign genetic materials, etc., can solve the problems of limited application range, higher base conversion than transversion, and many neutral mutations. and other issues to achieve targeted enhancement, increase abundance, and reduce workload

Inactive Publication Date: 2011-11-02
TIANJIN UNIV OF SCI & TECH
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In terms of protein function and structure research, prediction and discovery of new protein functions, error-prone PCR is an effective method, which can successfully change the stability, affinity and other functions of enzymes. The disadvantages of this method are: (1) The target sequence length is generally 0.5-1.0kb, and the application range is limited; (2) There are many neutral mutations; (3) The base conversion in the obtained DNA sequence is higher than the transversion
However, the country is only limited to the screening of low-temperature alkaline protease, and there are no reports on improving its thermal stability and improving its processing characteristics.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multifunctional shuttle vector new pBE2, construction method thereof and method for constructing alkali protease mutation library by using same
  • Multifunctional shuttle vector new pBE2, construction method thereof and method for constructing alkali protease mutation library by using same
  • Multifunctional shuttle vector new pBE2, construction method thereof and method for constructing alkali protease mutation library by using same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0037] Below in conjunction with the examples, the present invention is further described, the following examples are illustrative, not limiting, and the protection scope of the present invention cannot be limited by the following examples.

[0038] 1. Construction method of the multifunctional shuttle vector new pBE2:

[0039] (1) Carry out EcoRI / KpnI double enzyme digestion on the pWB980 vector to obtain a strong P43 promoter; carry out EcoRI / KpnI double enzyme digestion on the pBE2 vector, use a 50ul enzyme digestion system, and digest at 37°C for 3 hours;

[0040] (2) Ligate the pBE2 digested large fragment and P43, use 20ul ligation system, ligate at 16°C for 2 hours;

[0041](3) Design primers Psp1 and Psp2 to amplify the alkaline protease signal peptide and propeptide from the genome of Bacillus alkalophilus;

[0042] ① Design primers

[0043] P sp1 :

[0044] CGG GGTACC ATTATAGGTAAGAGAGGAATGTACACATGAAGAAACCGTTGGGGAAAATT

[0045] G; The horizontal line is the res...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a multifunctional shuttle vector new pBE2, a construction method thereof and a method for constructing an alkali protease mutation library by using the same. The main structure of the multifunctional shuttle vector is LB-P43-SP-MCS-RB. The construction method mainly comprises the following steps: connecting a big fragment of the pBE2 vector with a P43 strong promoter and the product of the amplification of surfactant protein (SP) and introducing a BamHI enzyme cutting site. The method for constructing the alkali protease mutation library mainly comprises: connecting a mature peptide fragment of an alkali protease gene of bacillus alcalophilus to the new pBE2, transferring into Escherichia coli to obtain a positive clone, transferring the positive clone into bacillus subtilis WB600 and performing several circles of high-flux screening. When the method for constructing the alkali protease mutation library, which is provided by the invention, is used, the pertinence to mutation of an alkali protease gene is increased, mutation is performed according to the mature peptide part of the alkali protease, and the workload required for oriented evolution study on the alkali protease is reduced greatly.

Description

technical field [0001] The invention relates to a shuttle vector, in particular to a multifunctional shuttle vector new pBE2 between Bacillus subtilis and Escherichia coli and its construction method and application. Background technique [0002] Introduction to pBE2 [0003] At present, many vectors that shuttle between Bacillus subtilis and E. coli have been constructed, and each of these vectors has its own advantages and uses. However, with the rapid development of genetic engineering and molecular biology, higher requirements are placed on the vector, such as multifunctionality and high-efficiency expression. Based on the respective characteristics of pUB110 and pGEM3, Guo Xinhua and others transformed pUB110 and pGEM3, and constructed the pBE2 vector through genetic engineering methods such as enzyme digestion and ligation. It replicates in Bacillus subtilis and is relatively stable in nature, and can be used for gene cloning and gene analysis of Bacillus subtilis. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/75C12R1/125C12R1/07
Inventor 路福平黎明梁晓梅王春霞成堃
Owner TIANJIN UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products