Multifunctional shuttle vector new pBE2, construction method thereof and method for constructing alkali protease mutation library by using same
A shuttle carrier and construction method technology, which is applied in the direction of microorganism-based methods, biochemical equipment and methods, and the use of vectors to introduce foreign genetic materials, etc., can solve the problems of limited application range, higher base conversion than transversion, and many neutral mutations. and other issues to achieve targeted enhancement, increase abundance, and reduce workload
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0037] Below in conjunction with the examples, the present invention is further described, the following examples are illustrative, not limiting, and the protection scope of the present invention cannot be limited by the following examples.
[0038] 1. Construction method of the multifunctional shuttle vector new pBE2:
[0039] (1) Carry out EcoRI / KpnI double enzyme digestion on the pWB980 vector to obtain a strong P43 promoter; carry out EcoRI / KpnI double enzyme digestion on the pBE2 vector, use a 50ul enzyme digestion system, and digest at 37°C for 3 hours;
[0040] (2) Ligate the pBE2 digested large fragment and P43, use 20ul ligation system, ligate at 16°C for 2 hours;
[0041](3) Design primers Psp1 and Psp2 to amplify the alkaline protease signal peptide and propeptide from the genome of Bacillus alkalophilus;
[0042] ① Design primers
[0043] P sp1 :
[0044] CGG GGTACC ATTATAGGTAAGAGAGGAATGTACACATGAAGAAACCGTTGGGGAAAATT
[0045] G; The horizontal line is the res...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap